ID: 1168561703

View in Genome Browser
Species Human (GRCh38)
Location 19:57390003-57390025
Sequence GAGTCAACTGACAAGCGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168561698_1168561703 -1 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561703 19:57390003-57390025 GAGTCAACTGACAAGCGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1168561699_1168561703 -2 Left 1168561699 19:57389982-57390004 CCACCACGGAGAGGCGGGAGTGA 0: 1
1: 0
2: 3
3: 7
4: 111
Right 1168561703 19:57390003-57390025 GAGTCAACTGACAAGCGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1168561700_1168561703 -5 Left 1168561700 19:57389985-57390007 CCACGGAGAGGCGGGAGTGAGTC 0: 1
1: 0
2: 4
3: 8
4: 119
Right 1168561703 19:57390003-57390025 GAGTCAACTGACAAGCGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168561703 Original CRISPR GAGTCAACTGACAAGCGCTG GGG Exonic
907143335 1:52209253-52209275 GAGTCAACTGACAATGGCAGGGG + Intronic
909942504 1:81626683-81626705 GAGTCAACTGGCCAGGGCGGTGG + Intronic
912443667 1:109717170-109717192 GAGTTAACTTAGAAGAGCTGGGG + Intronic
912629956 1:111238424-111238446 GAGTCAACTCAAAATCCCTGTGG - Intronic
913275063 1:117129194-117129216 GAGTCAATTGAGAAGAGCTAAGG - Intergenic
916103486 1:161412804-161412826 GAGTCAATGGCCAGGCGCTGTGG - Intergenic
917056071 1:170983061-170983083 GAGGCAACTGAAATGAGCTGAGG - Intronic
920525559 1:206663590-206663612 GGGGAAACTGACAAGCTCTGGGG - Intronic
920774920 1:208926744-208926766 GACTCAACTGACCAACGCAGAGG - Intergenic
921174654 1:212583603-212583625 GGGCCAACTGACAGGGGCTGTGG + Intronic
1071838417 10:89443255-89443277 GAGCCAAATGTCAAGCCCTGGGG + Intronic
1072037446 10:91576449-91576471 GAATCATCTGATAAGCCCTGGGG + Intergenic
1076511259 10:131015329-131015351 GAGACAAATGGCAAGCCCTGCGG + Intergenic
1079197059 11:18338160-18338182 GAGTCAAGTGATCAGTGCTGAGG + Exonic
1083169545 11:60914677-60914699 GCGTCCCCTGCCAAGCGCTGAGG - Intronic
1084106574 11:66984558-66984580 GACTCGACTGCCAGGCGCTGTGG - Intergenic
1102480864 12:113222035-113222057 GACCCAACTGGCCAGCGCTGGGG - Intronic
1104416348 12:128599187-128599209 GGGTCAAGGGACAAACGCTGGGG - Intronic
1108462262 13:50678431-50678453 GAGGCAACTAACAATCGCAGGGG - Intronic
1112075557 13:95909212-95909234 GGGTCAAATGACAAGCAATGGGG - Intronic
1113748394 13:112761992-112762014 GAGTCAACTGCCTAGCCCTGTGG + Intronic
1118774845 14:68967272-68967294 GAGACAACTGACAGATGCTGAGG - Intronic
1119565883 14:75629058-75629080 GAGTCAACTGCCCAGAACTGAGG + Intronic
1128691825 15:69730406-69730428 TTGTCCACTGACAAGCTCTGTGG - Intergenic
1130960894 15:88658018-88658040 GAGTCAGCTGACCTGGGCTGAGG + Intergenic
1141464848 16:84198607-84198629 GAGTCAACCTACAAGCACGGAGG - Intergenic
1152619405 17:81354481-81354503 AAGTCAGCTGACAGGCGCTGCGG - Intergenic
1163242064 19:16070391-16070413 ATGTCAACTGCCAAGCCCTGGGG + Intronic
1164850540 19:31479551-31479573 GAGTTAACTCAAAACCGCTGGGG - Intergenic
1166295119 19:41885128-41885150 TAGGCAACTGACAAGGCCTGGGG - Intronic
1167371673 19:49086136-49086158 GAGTCCTCTGACACGAGCTGTGG - Intronic
1167494502 19:49809602-49809624 GAGTCAGCAGACAAGCGTAGGGG + Intronic
1168561703 19:57390003-57390025 GAGTCAACTGACAAGCGCTGGGG + Exonic
927360144 2:22223625-22223647 GAGACATCTGACATGCCCTGGGG - Intergenic
927631774 2:24780736-24780758 GTGTCAGATGACAAGGGCTGTGG + Intergenic
927924188 2:26998403-26998425 GTGTCATCTGACAAGCCCAGAGG + Intronic
934077686 2:88441857-88441879 GAGCCCACTCACAAGCACTGTGG - Intergenic
1169434764 20:5576477-5576499 AAGTCAACTGAGAATCTCTGGGG + Intronic
1175423760 20:58851856-58851878 GAGCTGACTGACCAGCGCTGCGG + Intronic
1179944426 21:44661690-44661712 GAGGAAACTTACAAGCACTGTGG + Intronic
1184722910 22:46325795-46325817 GAGTCAACTGGCATTTGCTGTGG - Intronic
965746672 3:171933626-171933648 AAGACAACTGAAAAACGCTGTGG + Intronic
979100700 4:116609235-116609257 GAGACAAATGACAAACACTGGGG + Intergenic
988900694 5:35729351-35729373 GGGCCATCTGACAAGAGCTGTGG + Intronic
992962798 5:81972318-81972340 GAGACAACCGGCAAGGGCTGTGG - Intronic
1002011839 5:176289716-176289738 GATTGACCTGACAAGAGCTGAGG + Intronic
1002215930 5:177632656-177632678 GATTGACCTGACAAGAGCTGAGG - Intergenic
1003117963 6:3295797-3295819 GAGTCCACTGTGAAGGGCTGCGG + Intronic
1004184057 6:13406880-13406902 GAGAGAACTGACAAGGGCAGAGG - Intronic
1007738293 6:43995411-43995433 AAGTCAACAGACAAGTGGTGGGG - Intergenic
1009487988 6:64249718-64249740 GAATCACCTGATAAGAGCTGTGG + Intronic
1014007829 6:116441782-116441804 AACTCAACTGAAAAGTGCTGTGG - Intergenic
1016536848 6:145116541-145116563 GTGTCTACTGAAAAGCCCTGGGG + Intergenic
1017724095 6:157265008-157265030 GAGTCTCCTAACAAGCACTGTGG + Intergenic
1022194104 7:28047119-28047141 GAGTCAACTGGCAATCTCTTTGG - Intronic
1030677444 7:112398746-112398768 AAGTCACCTGACAAGGGCTATGG - Intergenic
1031733821 7:125331517-125331539 GAGTGAAGTGACAATGGCTGAGG + Intergenic
1032057892 7:128698228-128698250 AAGTCAACAGAGAAGCACTGGGG - Intergenic
1032782124 7:135171767-135171789 GAGGTGACTGACAAGCCCTGTGG + Intergenic
1041702704 8:60809327-60809349 GTGTAAACTGACATGCTCTGAGG - Intronic
1043691535 8:83159547-83159569 TAGTCAACTGAAAAGCACTGGGG + Intergenic
1044199794 8:89421053-89421075 AAGTAAACTGACAAGTTCTGAGG - Intergenic
1045418909 8:101994580-101994602 AAGTCCAATGACAAGGGCTGAGG + Intronic
1048057559 8:130882547-130882569 TAGTCAACAGACAAGAGCAGTGG + Intronic
1056569470 9:87802984-87803006 CAGTCAAATGACAGGCTCTGTGG + Intergenic
1057960657 9:99453413-99453435 GTGTCTTCTGAGAAGCGCTGTGG - Intergenic
1059328309 9:113518183-113518205 GACTGAACTGACCAGCTCTGGGG - Intronic
1190589868 X:51988932-51988954 CACTCAAATGACAAGTGCTGGGG - Intergenic
1191666472 X:63707575-63707597 GAGACAACTGGCAAGCTCTTTGG - Intronic
1192252720 X:69426185-69426207 GAGTCAACTGACAGAAGCTAGGG - Intergenic