ID: 1168561723

View in Genome Browser
Species Human (GRCh38)
Location 19:57390097-57390119
Sequence CTGATGAACCTGACTGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168561719_1168561723 2 Left 1168561719 19:57390072-57390094 CCTGGCTGGGCTGGCGGAGGCCT 0: 1
1: 0
2: 4
3: 66
4: 659
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561718_1168561723 3 Left 1168561718 19:57390071-57390093 CCCTGGCTGGGCTGGCGGAGGCC 0: 1
1: 0
2: 17
3: 298
4: 1444
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561714_1168561723 11 Left 1168561714 19:57390063-57390085 CCGCTCTTCCCTGGCTGGGCTGG 0: 2
1: 1
2: 9
3: 59
4: 503
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561709_1168561723 16 Left 1168561709 19:57390058-57390080 CCGCCCCGCTCTTCCCTGGCTGG 0: 1
1: 3
2: 6
3: 37
4: 411
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561706_1168561723 28 Left 1168561706 19:57390046-57390068 CCTTTGTCGCTCCCGCCCCGCTC 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561712_1168561723 13 Left 1168561712 19:57390061-57390083 CCCCGCTCTTCCCTGGCTGGGCT 0: 1
1: 1
2: 3
3: 42
4: 334
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561713_1168561723 12 Left 1168561713 19:57390062-57390084 CCCGCTCTTCCCTGGCTGGGCTG 0: 1
1: 1
2: 6
3: 85
4: 555
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145
1168561708_1168561723 17 Left 1168561708 19:57390057-57390079 CCCGCCCCGCTCTTCCCTGGCTG 0: 2
1: 2
2: 14
3: 87
4: 605
Right 1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG 0: 1
1: 1
2: 0
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168561723 Original CRISPR CTGATGAACCTGACTGAGGT GGG Exonic
900750116 1:4390357-4390379 CTGAGAAAACTGACTTAGGTGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
906521491 1:46469530-46469552 GTGATGAGCCTGAATGGGGTGGG - Intergenic
909203768 1:72726662-72726684 CTGATGTACCTGAAAGAGATAGG + Intergenic
912704510 1:111902075-111902097 CTGCTGCACCTGAGTGAGGCCGG - Intronic
916575388 1:166062451-166062473 CTGATGAACGTGCCTGAAGAAGG + Intronic
917655104 1:177118399-177118421 CTGTGGAATATGACTGAGGTGGG + Intronic
918387740 1:184027413-184027435 CTGATGAATGTGACTGAAATGGG + Intronic
919804459 1:201372894-201372916 CTCCTGAAACTGACTGAGGAAGG - Intronic
921588519 1:216976865-216976887 CTAATGAACTTGACTTAGGCTGG - Intronic
922367480 1:224879327-224879349 CTGATGAACCTCACAGAGGAAGG - Intergenic
922534575 1:226370434-226370456 CTGCTGGACCTCACTGAGGATGG + Exonic
923128179 1:231050653-231050675 CTGAAGGACCTGCCTGAGGCTGG + Intergenic
923192336 1:231631410-231631432 CTGAAGGACCTGCCTGAGGCGGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
1065654297 10:27931492-27931514 CTGAAGGACCTGATTGAGCTGGG - Intronic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1067769349 10:49112138-49112160 TTGGGGAACCTGACTGGGGTAGG - Intronic
1068268392 10:54685236-54685258 TTGAAGAACCTGTCTGAGGGTGG + Intronic
1068764500 10:60748088-60748110 CAGGTGAATCTGATTGAGGTAGG - Intergenic
1070577405 10:77689648-77689670 CTGATGAACTGAACTGAGCTGGG + Intergenic
1072615448 10:97046507-97046529 CTGAGGATCCTGACTGTGTTGGG - Intronic
1073591737 10:104764296-104764318 CTGATGAAGCGGTCTGAGGTGGG + Intronic
1074949909 10:118323051-118323073 CTGAGGAAACTGACTGACTTGGG + Intronic
1088511563 11:110580777-110580799 CTGATAAAACTCCCTGAGGTAGG + Exonic
1089357794 11:117866515-117866537 CTGCTGACTATGACTGAGGTTGG + Intronic
1101744484 12:107528192-107528214 CAGATGATCCTGAGTCAGGTAGG + Intronic
1101832259 12:108268049-108268071 CTTATGTAACTAACTGAGGTTGG - Intergenic
1102015415 12:109644976-109644998 TTGATGAATCTGACATAGGTGGG - Intergenic
1102325187 12:111975254-111975276 CTCAAGAGGCTGACTGAGGTGGG - Intronic
1104685907 12:130783759-130783781 CTGATGCACCTGTGTGAGGGTGG - Intergenic
1108706878 13:52996955-52996977 CTGATTAACCTTACTGAGTCTGG + Intergenic
1108992913 13:56685970-56685992 CTGATGTAGCTGACCGAAGTTGG + Intergenic
1111384424 13:87505538-87505560 ATGATTAAGCTTACTGAGGTAGG - Intergenic
1112888723 13:104206461-104206483 CTATTGAAGCTGACTGATGTGGG - Intergenic
1114355693 14:21905585-21905607 CTCAGGAAGCTGACTGAGGTGGG - Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1117972935 14:61270169-61270191 CTGATGAAAGACACTGAGGTTGG + Intronic
1120778443 14:88463279-88463301 CTAATGAAACTGTCTGAAGTGGG - Intronic
1120968783 14:90190692-90190714 CTGATGATGCTGAATGAGGCGGG - Intergenic
1122543000 14:102508270-102508292 CGTATGAACCTGGCTTAGGTGGG - Intronic
1133080484 16:3315127-3315149 CTGATGCCCCTTACTGAGATGGG - Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1137934429 16:52620886-52620908 CAGCTGAACCTGACCTAGGTAGG + Intergenic
1141269577 16:82526754-82526776 TTGATAATCATGACTGAGGTGGG - Intergenic
1141426127 16:83945902-83945924 CTGATGACCCTGGTTGGGGTGGG - Intronic
1144712890 17:17414047-17414069 CTGATCAGCCTGGCTGGGGTAGG - Intergenic
1146115395 17:30133049-30133071 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1146730187 17:35186437-35186459 CTGGAGATCCTGACTGTGGTGGG + Exonic
1147042960 17:37732006-37732028 CTGATGAAGATGGCTGAAGTGGG + Intronic
1148166082 17:45484970-45484992 CTGAGGGACCTGACTTAGGGAGG - Intronic
1150329649 17:64284593-64284615 CTGCTGATCCTGTCTGTGGTGGG + Intergenic
1150397305 17:64831694-64831716 CTGAGGGACCTGACTTAGGGAGG - Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1153720034 18:7892312-7892334 TTAATGCAGCTGACTGAGGTAGG - Intronic
1155819688 18:30359728-30359750 CTGCTGAACCAGGTTGAGGTGGG - Intergenic
1157174647 18:45440343-45440365 TTGACAAACCTGGCTGAGGTGGG - Intronic
1159651956 18:70988109-70988131 CTGATGAGCCTTCTTGAGGTTGG + Intergenic
1160821183 19:1058923-1058945 CTGAGGAACTTGACCAAGGTAGG + Exonic
1161120589 19:2523659-2523681 CTGTGGAACCTGAGTGAGGCTGG + Intronic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1162249552 19:9430749-9430771 CTGATTTACATGACTGATGTTGG - Intronic
1168051035 19:53830153-53830175 CTGATGAAAGTGACTGTGGCTGG - Intergenic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
1168564397 19:57411389-57411411 CCGATGAACCTGACTGAGGTGGG + Exonic
924968658 2:102164-102186 CTAATGTACCTGACTGAAGAAGG - Intergenic
926175710 2:10590216-10590238 CTTGGGAGCCTGACTGAGGTGGG - Intronic
928261546 2:29771940-29771962 CTCAGGAAGCTGACTGAGGAGGG + Intronic
932430314 2:71670268-71670290 CTGCTTAACTTGTCTGAGGTAGG - Intronic
933592113 2:84244573-84244595 CTGATGAGAATGAATGAGGTGGG - Intergenic
933834956 2:86238584-86238606 CTGATGCATCAGGCTGAGGTGGG - Intronic
937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG + Intergenic
937347388 2:121134824-121134846 CTGCTGGACCCGCCTGAGGTAGG - Intergenic
939308745 2:140444558-140444580 CTGATGAACTCAACTGTGGTAGG - Exonic
941374338 2:164708336-164708358 ATGATCATCCTGACTGGGGTAGG + Intronic
941651494 2:168097327-168097349 CTGTAGAACCTAAATGAGGTGGG - Intronic
946654515 2:221931644-221931666 CTCATGAACATGAATGAGGTAGG + Intergenic
948721661 2:239904679-239904701 CTGATGCACCAGGCTGGGGTGGG - Intronic
1168795583 20:608590-608612 CTGATGAGCCAGACAGAGGGTGG + Intronic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1170615862 20:17950236-17950258 CTGATGAGCCTGGCTGTGTTTGG - Intronic
1172389541 20:34557815-34557837 CTGAGGAGGCTGACTGAGGCAGG + Intronic
1173793514 20:45843018-45843040 CTGATTAACCTGATTGGGATCGG - Intronic
1175968757 20:62673351-62673373 CTGATGAACATGGCAAAGGTGGG - Intronic
1178892312 21:36530436-36530458 CTGGTTGACCTGCCTGAGGTGGG - Intronic
1179820915 21:43936281-43936303 CTGAGGAACCCGGCTGGGGTTGG - Intronic
1183945428 22:41323219-41323241 CTGATGAACAAGTCTGAGGAGGG - Intronic
1184935341 22:47716658-47716680 CCGCTGAACCTGACTGGGCTGGG - Intergenic
953384101 3:42495857-42495879 CTGAACAACCTGACTGAACTTGG + Intronic
953414122 3:42705787-42705809 CTGAGAAACCTAACTTAGGTGGG - Intronic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
954772729 3:52987180-52987202 CTGAAGGACCTGTCTGAGGCTGG + Intronic
954964849 3:54601313-54601335 CTCAGGAGACTGACTGAGGTAGG - Intronic
956235906 3:67070599-67070621 CCCATTAACCTGACTGAGGCAGG - Intergenic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
959248354 3:103904783-103904805 CTGAAGAACTTAACTGAGATTGG + Intergenic
959272000 3:104223597-104223619 CTGAAGAACCTGCCTGAAGCTGG - Intergenic
964428591 3:156579778-156579800 ATTATGAACCTGGCTGAGGTGGG - Intergenic
964428645 3:156580132-156580154 ATTATGAACCTGGCTGCGGTGGG + Intergenic
972382375 4:38531327-38531349 CTGAGGAACCAGACAGAGCTGGG + Intergenic
972765135 4:42145953-42145975 CAGATTTACTTGACTGAGGTAGG + Intronic
974243908 4:59289195-59289217 CAGATGAACATGAATGAGGAAGG - Intergenic
975123350 4:70753971-70753993 ATGATGAACTTCACTGAGTTAGG - Intronic
976916135 4:90376695-90376717 CTGATTAATCTGACAGAGGCTGG - Intronic
979917115 4:126449643-126449665 ATGATGAAAGTGACTGTGGTGGG - Intergenic
980143343 4:128948783-128948805 CTAATTAAACAGACTGAGGTTGG + Intronic
983145158 4:164204796-164204818 CTGATGAAGCTGAATAAGGCTGG - Intronic
983484738 4:168320099-168320121 CTGATGTACCTGCCTGGGGTAGG + Intergenic
983685778 4:170407122-170407144 CTGATGTGCCTGAGTGATGTGGG + Intergenic
984868643 4:184307922-184307944 CTGATGGGCCTGCCTGAGGCTGG + Intergenic
987963465 5:24841022-24841044 CTGTTGAACCTGAGGGATGTGGG - Intergenic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
992407990 5:76477798-76477820 TTGATGATCCTGACTCATGTGGG + Intronic
995399004 5:111719498-111719520 ATTATGAAGATGACTGAGGTGGG + Intronic
995802014 5:116007353-116007375 CCGATGAAGCTAACTGAGGCAGG - Intronic
996390964 5:122961163-122961185 CTGATGAAACTGAGTAAAGTTGG + Intronic
999211684 5:149894950-149894972 CCAAATAACCTGACTGAGGTTGG + Intronic
1000017038 5:157287215-157287237 CAGATGATTCTGACTGAGGCAGG - Intronic
1000993522 5:167935370-167935392 CTGATGGACAGGACTGATGTGGG + Intronic
1001187454 5:169588558-169588580 ATGATGACCATGACTGAGGTAGG + Exonic
1003103235 6:3193555-3193577 CTGCTGAACCTCACCGCGGTCGG + Intergenic
1004643072 6:17534454-17534476 CCCAGGAACCTGACTGAGATGGG - Intronic
1005822424 6:29608686-29608708 CTGAACAACCTGACTGCTGTGGG - Exonic
1010942870 6:81939684-81939706 CTGATCAAGCTGACTTAGATTGG + Intergenic
1014337676 6:120157900-120157922 CTGATAAACTTGCCTGATGTAGG + Intergenic
1018277451 6:162148042-162148064 CTGATGTAGCTGACTGAGACAGG - Intronic
1021696537 7:23281775-23281797 CTGAAGGACCTGCCTGAGGCTGG - Intergenic
1023125637 7:36951566-36951588 CTGATGAATCAGACTGAAGTGGG + Intronic
1023889413 7:44381757-44381779 CTCGTGAACCTGCCTGAGGGTGG + Exonic
1024295603 7:47839582-47839604 CTGATGAACCAGCCTGGGGAAGG + Exonic
1025981223 7:66408549-66408571 CTGATGAAGATGACTGAGTACGG + Intronic
1027206093 7:76100714-76100736 CTGATGAAGATGACTGAGTATGG + Intergenic
1027462226 7:78468808-78468830 CTAATAAATCTGATTGAGGTAGG + Intronic
1029367221 7:100124422-100124444 CTGCTCAACCTGACTGATTTTGG - Intronic
1030515803 7:110536090-110536112 CTCATGAACCTGACGGAGAGTGG - Intergenic
1030803788 7:113888483-113888505 CTGATGAATGCGGCTGAGGTTGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1039740122 8:40375160-40375182 CAAATCAACCTGACTGAGGTGGG + Intergenic
1039930908 8:41987787-41987809 GTGATGAACATGACTGGGATAGG - Intronic
1042604853 8:70535196-70535218 CTGAGGTAAGTGACTGAGGTGGG - Intergenic
1045377305 8:101586802-101586824 CTGAGAAATCTGACTGGGGTTGG + Intronic
1047393842 8:124475503-124475525 GTGTTGTACCTGAGTGAGGTGGG + Intronic
1048876162 8:138838230-138838252 CTGAGGAATCTCACAGAGGTGGG + Intronic
1049337737 8:142095562-142095584 CTGAGGAACCTTACTGGGGAGGG + Intergenic
1049904963 9:208052-208074 CTGACGAGCCAGACTTAGGTTGG + Intergenic
1059925846 9:119208457-119208479 CTGATTCACCTGATTGAGGAGGG - Intronic
1060134736 9:121142391-121142413 GTGCTGAACCTGACCTAGGTGGG + Intronic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1187376565 X:18760717-18760739 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1188031641 X:25270338-25270360 CTGATGAAAATGACTGACGCTGG - Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1192568803 X:72185256-72185278 CAGATGAGCCTGCCTGAGGGAGG - Intronic
1196001641 X:110793620-110793642 AGGAAGAACCTCACTGAGGTGGG - Intronic
1196990427 X:121322772-121322794 GTGATCACCCTGACTGAAGTAGG + Intergenic
1198987450 X:142471956-142471978 CTGTTCAAAATGACTGAGGTAGG - Intergenic
1200408242 Y:2836521-2836543 CTGATAAGCCTTTCTGAGGTAGG + Intergenic