ID: 1168563024

View in Genome Browser
Species Human (GRCh38)
Location 19:57399085-57399107
Sequence CTCGCTTATGTCTCATGAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168563024_1168563028 17 Left 1168563024 19:57399085-57399107 CCGACTCATGAGACATAAGCGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1168563028 19:57399125-57399147 CCTTATGAGTGCAACACATGTGG 0: 1
1: 1
2: 8
3: 44
4: 253
1168563024_1168563026 -6 Left 1168563024 19:57399085-57399107 CCGACTCATGAGACATAAGCGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1168563026 19:57399102-57399124 AGCGAGTTCACACTGGAGAAAGG 0: 1
1: 22
2: 39
3: 62
4: 212
1168563024_1168563029 18 Left 1168563024 19:57399085-57399107 CCGACTCATGAGACATAAGCGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1168563029 19:57399126-57399148 CTTATGAGTGCAACACATGTGGG 0: 1
1: 1
2: 8
3: 31
4: 188
1168563024_1168563030 30 Left 1168563024 19:57399085-57399107 CCGACTCATGAGACATAAGCGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1168563030 19:57399138-57399160 ACACATGTGGGAAATTCTTTCGG 0: 1
1: 1
2: 2
3: 34
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168563024 Original CRISPR CTCGCTTATGTCTCATGAGT CGG (reversed) Exonic
915737928 1:158096294-158096316 CTCTCCTATGTCCCATCAGTTGG + Intronic
1067794412 10:49310344-49310366 CCCGCTTATGGCTCATGGGCTGG - Intronic
1073812477 10:107165167-107165189 CTCTCTTATGCTTCCTGAGTTGG + Intergenic
1080395716 11:31888014-31888036 CTAACTTAGGTCACATGAGTAGG - Intronic
1083826947 11:65209399-65209421 TTTGCTTTTGTCTCCTGAGTGGG + Intronic
1088140435 11:106609295-106609317 CTGAATTATGTCTCATTAGTTGG + Intergenic
1096851082 12:54437918-54437940 CTCACTTAGGCCTCCTGAGTAGG + Intergenic
1102314938 12:111879979-111880001 CTCTCTAATGTCCCATGAGGAGG - Intronic
1104802656 12:131565309-131565331 CACGCTTGTGTCTCTTGGGTGGG - Intergenic
1106844031 13:33718374-33718396 ATAGGGTATGTCTCATGAGTGGG - Intergenic
1108366889 13:49724706-49724728 CTCGCCTCTGTCTCCTGAGTAGG + Intronic
1112101415 13:96193704-96193726 CTAGCCTATGTCTTAAGAGTTGG + Intronic
1115572841 14:34683075-34683097 GTTGCTTCTGTCTCTTGAGTTGG + Intergenic
1119279648 14:73394518-73394540 CTGGCCTATGCCTCCTGAGTAGG + Intronic
1124854776 15:33377242-33377264 CTTGCTCATGTCACATGAGTTGG + Intronic
1126910438 15:53411869-53411891 GTCAATTATGTCTCATGGGTTGG + Intergenic
1131395467 15:92082122-92082144 CTTGCTTATGTCTGAGGAGGAGG - Intronic
1139694528 16:68664385-68664407 CTCATTTATTTCTCATGAGAAGG - Intronic
1140291422 16:73662379-73662401 CTCCCTTATTTCTCATTAGATGG + Intergenic
1156460090 18:37316736-37316758 GTCTTTCATGTCTCATGAGTAGG + Intronic
1167506895 19:49875751-49875773 TTTGCTCATGTCTCCTGAGTTGG - Intronic
1167828160 19:51993731-51993753 TTCGCTGATGTCTGATGAGTGGG + Exonic
1168563024 19:57399085-57399107 CTCGCTTATGTCTCATGAGTCGG - Exonic
931385132 2:61791741-61791763 CTCGCTAAGATCTCAGGAGTGGG + Intergenic
943530440 2:189073039-189073061 CTCCCTTGTTTCTCATAAGTAGG - Intronic
944294844 2:198050379-198050401 CCCTCTTATGTCTCAGGAGATGG + Intronic
948109018 2:235439649-235439671 ATGGCTAATGTCTCATGACTTGG - Intergenic
948335384 2:237203106-237203128 CTCTCTCATGTCTCATGCCTTGG - Intergenic
1169641984 20:7762397-7762419 CTCGGTTATATTTTATGAGTTGG - Intergenic
1175894539 20:62330271-62330293 CTCGCCTCTGTCTCGTGCGTTGG - Intronic
1176992316 21:15512079-15512101 CTTGCTTATGTGTCATTAGTAGG - Intergenic
949186654 3:1200143-1200165 CCTGCTTCAGTCTCATGAGTAGG + Intronic
953705479 3:45226694-45226716 CTTGTTTCTGGCTCATGAGTTGG - Intergenic
956018730 3:64911471-64911493 CTCATTTATGTCTTATAAGTGGG - Intergenic
956521326 3:70107378-70107400 CTAGCTTATGTGTCATAAATTGG + Intergenic
959359899 3:105375234-105375256 CTGGTTTATGCCTCATGAGCTGG + Intronic
964143981 3:153436207-153436229 CTTTCTGATGTCTCATCAGTCGG + Intergenic
969933737 4:10659938-10659960 CTTTCTTATGTCTCATCTGTAGG + Intronic
978355016 4:107862972-107862994 CTCGCTTATGTGTTATAAGGTGG + Intronic
983675791 4:170290513-170290535 CTCACTAATGCCCCATGAGTTGG + Intergenic
985904621 5:2823593-2823615 CTCGCTTATTTTACATCAGTGGG + Intergenic
987019904 5:13859533-13859555 CTCGATGATGTCTGTTGAGTTGG + Exonic
996838784 5:127823401-127823423 CTCCATTATGCCACATGAGTGGG + Intergenic
1006595181 6:35187919-35187941 CTTGGTTATGTTTGATGAGTGGG + Intergenic
1014168226 6:118249762-118249784 CTTGTTTATGTCTTCTGAGTTGG + Intronic
1020433369 7:8135830-8135852 CTCACCTAAGTCTCATAAGTTGG - Intronic
1027430782 7:78110532-78110554 CAGGCTTATGTCTCATTATTTGG - Intronic
1031352755 7:120755467-120755489 CTCACTAATCTCTCATTAGTCGG - Intergenic
1034912770 7:155011097-155011119 CTCGCTTCTCACTCATGTGTTGG + Intergenic
1041113452 8:54509470-54509492 CTTGCTTATGGCTCCTGAGTGGG + Intergenic
1041795552 8:61743739-61743761 CTCTATGATGTCTCATGAGCAGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1051536057 9:18159309-18159331 CAAGCTCATGTCTCATGGGTAGG - Intergenic
1056591299 9:87968031-87968053 CTTGCTTATGTCTCAAGTCTTGG - Intronic