ID: 1168564014

View in Genome Browser
Species Human (GRCh38)
Location 19:57407658-57407680
Sequence CTTTGAAAGGTGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13443
Summary {0: 1, 1: 15, 2: 96, 3: 1164, 4: 12167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168564014_1168564021 -8 Left 1168564014 19:57407658-57407680 CCTTCCACCTCCACCTTTCAAAG 0: 1
1: 15
2: 96
3: 1164
4: 12167
Right 1168564021 19:57407673-57407695 TTTCAAAGTACTGGGATTACAGG 0: 30
1: 1414
2: 32101
3: 335052
4: 260081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168564014 Original CRISPR CTTTGAAAGGTGGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr