ID: 1168564481

View in Genome Browser
Species Human (GRCh38)
Location 19:57411756-57411778
Sequence CAGGATGTTAAACCAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168564476_1168564481 7 Left 1168564476 19:57411726-57411748 CCAGAGGTAGACGTTTAAAGTTG 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG 0: 1
1: 0
2: 2
3: 11
4: 168
1168564475_1168564481 8 Left 1168564475 19:57411725-57411747 CCCAGAGGTAGACGTTTAAAGTT 0: 1
1: 0
2: 2
3: 8
4: 99
Right 1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG 0: 1
1: 0
2: 2
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168564481 Original CRISPR CAGGATGTTAAACCAGGACA AGG Intronic
901531950 1:9859243-9859265 CAGCTTTCTAAACCAGGACAGGG + Intronic
901902279 1:12375601-12375623 CAGGGTGTTCATACAGGACATGG - Intronic
902585308 1:17435542-17435564 CAGGAGGCCAACCCAGGACAAGG + Intronic
902974521 1:20079399-20079421 CAGGATTTGAACCCAGGACTTGG + Intronic
903686426 1:25135530-25135552 CAGAAAGCTATACCAGGACATGG + Intergenic
905467476 1:38166394-38166416 CAGGATGTCAGAGCAGGAGAGGG - Intergenic
905852504 1:41284385-41284407 CAGTGTGTTCAAGCAGGACAAGG - Intergenic
906702140 1:47867285-47867307 CAGGATGTGAAACTAGGAGCTGG + Intronic
908008709 1:59753844-59753866 CAGGATTTTTAACCAGAGCAGGG - Intronic
910858843 1:91723593-91723615 CAGGTTATTCAACAAGGACATGG + Intronic
911170350 1:94764842-94764864 GAGGAAGATAAAGCAGGACAGGG - Intergenic
911742963 1:101407568-101407590 CTTCATGTTAATCCAGGACAGGG - Intergenic
915590446 1:156867387-156867409 CAGGATGAGAAACCAGGCAAGGG - Intronic
917401981 1:174659960-174659982 CAGGATATTAACCCACAACACGG + Intronic
917597138 1:176540332-176540354 CAGGGTCTTAAACAAAGACAAGG - Intronic
918559666 1:185849291-185849313 CAGGATTTTAAACTAGGTTAAGG - Intronic
919184033 1:194120814-194120836 CAGTGTGTGAAAGCAGGACATGG + Intergenic
920964841 1:210693118-210693140 CAGGGTCTGAAACCAGCACACGG - Intronic
923001636 1:230011141-230011163 TCGGATGATAAACCAGGTCAGGG - Intergenic
923010232 1:230082809-230082831 CAGGATGATAGAGCAGGATAAGG + Intronic
923641665 1:235768003-235768025 CAGGATGTGAAACCAGAAAAAGG - Intronic
1064911202 10:20403777-20403799 CAGGAGGCTAAGCCAGGACCAGG - Intergenic
1066754886 10:38701063-38701085 CAGGATCTCAAAACAGCACAGGG + Intergenic
1067531368 10:47076335-47076357 CTGTGTGTTAAAGCAGGACATGG + Intergenic
1070723223 10:78770997-78771019 CAGGATTTGAAACCAGGACAGGG - Intergenic
1072274192 10:93806565-93806587 CAGGATTTGAAAACAGGAAATGG - Intergenic
1072455210 10:95569217-95569239 GAGGATGTTATACCCGGACTAGG + Intergenic
1075837418 10:125466604-125466626 CAGGATTTGAAGCCAGGTCATGG + Intergenic
1077496153 11:2887276-2887298 CAGGGCGTTAACCCAGGAGAGGG + Intergenic
1077677611 11:4210420-4210442 AAGAATGTTAAAACAGGCCATGG - Intergenic
1077892313 11:6428173-6428195 CAGGATGACGAACCAGGAAAAGG + Intergenic
1077896907 11:6459871-6459893 CAGTAAATTCAACCAGGACAAGG - Intronic
1078799367 11:14627524-14627546 CAGGATTTGAACCCAGGCCATGG - Intronic
1081429982 11:42966309-42966331 CAGCATGTTCAAAGAGGACAGGG + Intergenic
1085783974 11:79435658-79435680 CTGTTTGTTAGACCAGGACAGGG + Intronic
1087419095 11:97897858-97897880 GAGGATGTTAAATCAGTTCAGGG - Intergenic
1088359173 11:108973276-108973298 CAGGATAGGAAATCAGGACAGGG - Intergenic
1089915353 11:122150122-122150144 TAAGATGTAATACCAGGACATGG - Intergenic
1090005950 11:123002454-123002476 AAGGCTGTTAAAGTAGGACAAGG + Intergenic
1091862826 12:3801953-3801975 TTGGATGTTAATCCAGCACAGGG + Intronic
1096515679 12:52153883-52153905 CAGGACTTTAAACCAGGAGCTGG - Intergenic
1100607985 12:96167503-96167525 AAGGATGATGAACCAGGAGAGGG + Intergenic
1102542920 12:113635254-113635276 CAGGATGTCAAAACAGGGCAAGG + Intergenic
1103728111 12:123008949-123008971 GAGGATGTTAATTCAGGACAAGG + Intronic
1104025783 12:125025174-125025196 CAGGATGTACACGCAGGACATGG - Exonic
1105807102 13:23959796-23959818 AAAGATGTTTAACCAGGCCAGGG + Intergenic
1106255287 13:28016903-28016925 CTGGATGTTCACCCTGGACAAGG + Intronic
1108026511 13:46183816-46183838 CAGGATGTGGAACCAGATCAGGG - Intronic
1108095408 13:46895499-46895521 CAGGATGGTTAACATGGACACGG + Exonic
1108519538 13:51234004-51234026 CAGGATGTCAAACTGGGACTGGG - Intronic
1109826758 13:67731492-67731514 GAGGATGTGAAATGAGGACATGG - Intergenic
1109901812 13:68782696-68782718 CAGAATGTTAAAGGAGAACAAGG - Intergenic
1110115013 13:71803243-71803265 CAGGATGTTAAAGCACTACCAGG - Intronic
1112957904 13:105084286-105084308 AAGGATGCTAGCCCAGGACATGG - Intergenic
1113435565 13:110288673-110288695 CAGGGTTTTACACAAGGACATGG - Intronic
1116868188 14:50048243-50048265 CAGGGTCATGAACCAGGACATGG - Intergenic
1119886917 14:78151213-78151235 CAGGAGGTAAAACCAGGACTAGG - Intergenic
1120673875 14:87396061-87396083 CAGCATGTCAAACCAGGCCGTGG + Intergenic
1120898081 14:89552150-89552172 CATGATGTTAAGACAGGACTTGG + Intronic
1121080988 14:91108240-91108262 CAAAATTTTAAACGAGGACAGGG - Intronic
1126720994 15:51579520-51579542 CACAATGGTAAACAAGGACAAGG - Intronic
1126882245 15:53111685-53111707 CAGGCTGTTCAAGCAGGAAAAGG - Intergenic
1128621938 15:69158662-69158684 CAAGTTTTCAAACCAGGACAAGG + Intergenic
1128825350 15:70710783-70710805 GAGGATGGTGAACCAGGAGAGGG - Intronic
1129439251 15:75568183-75568205 TAGGTTGTTAAACATGGACATGG - Intronic
1135258883 16:20964122-20964144 CAGGATGTTACCCTTGGACATGG + Exonic
1136727800 16:32375775-32375797 CAGGATCTCAAAACAGCACAGGG - Intergenic
1137808362 16:51329226-51329248 CTGGATTGCAAACCAGGACAGGG + Intergenic
1140796845 16:78446346-78446368 CAGGATGTTGACCAAGGCCATGG - Intronic
1142191413 16:88719941-88719963 CAGGATGTTCAACCAGAATGTGG - Exonic
1202998635 16_KI270728v1_random:141979-142001 CAGGATCTCAAAACAGCACAGGG + Intergenic
1203130232 16_KI270728v1_random:1678383-1678405 CAGGATCTCAAAACAGCACAGGG + Intergenic
1143423101 17:6811670-6811692 CAGGATGTGGCAACAGGACAGGG + Intronic
1146824067 17:36008397-36008419 CAGGATGTCAGACAAGGACCTGG + Intergenic
1149395091 17:56232146-56232168 GAGGATGTTTAGCCTGGACAAGG - Intronic
1150391733 17:64793868-64793890 CAGGATGTCAGCCCAGGACTGGG + Intergenic
1152586523 17:81191837-81191859 CAGGGTGTGAAACCAGGTGACGG + Intronic
1153034163 18:743283-743305 CTAGAGGTTAAACTAGGACAAGG - Exonic
1153429268 18:4997993-4998015 TAAGATGCTAAACTAGGACAAGG + Intergenic
1157340027 18:46770290-46770312 AAGGATGAGAAACCAGGAGATGG - Intergenic
1157502489 18:48201342-48201364 CAGGATGTAAATCCAGGGGACGG + Intronic
1157697460 18:49734163-49734185 GAAGATGTAAAACCAGGAAAGGG + Intergenic
1167659173 19:50785966-50785988 CAGGATGGTGAACAAGGCCATGG + Intergenic
1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG + Intronic
1168567360 19:57435963-57435985 CAGGATGTTGAACGGGGGCAGGG + Intronic
925288440 2:2730713-2730735 CAGGAAGTTAAAGCCGGGCAAGG - Intergenic
930318981 2:49830717-49830739 CAGGATGTTGAACCATTACTGGG + Intergenic
930753506 2:54954150-54954172 CAGGAAGGTAAACCAGCACTGGG + Exonic
931747197 2:65300620-65300642 CAGGATGTGGAGCCAGGAGAGGG - Intergenic
932110246 2:68992747-68992769 CTGGATGTAAAAGCAGGACAAGG - Intergenic
934318170 2:91945298-91945320 CAGGATCTCAAAACAGCACAGGG + Intergenic
936389679 2:112059799-112059821 CAGGAAGTAGAACCATGACAAGG + Intronic
936598989 2:113877097-113877119 CAGCATGTCAAAACAGGAGATGG - Intergenic
937863083 2:126728370-126728392 CAAGATGAAAAACAAGGACAAGG + Intergenic
939425872 2:142035760-142035782 CAGAATGTTACACCACGATATGG + Intronic
940285104 2:152026223-152026245 CTGGATCTTACTCCAGGACAGGG + Intronic
941670237 2:168284999-168285021 CATGATAATAAGCCAGGACAGGG + Intergenic
945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG + Intergenic
946170303 2:217891321-217891343 CAGGAACTTGTACCAGGACACGG - Intronic
946492709 2:220165494-220165516 CAGGTTAGGAAACCAGGACATGG - Intergenic
1170298859 20:14859872-14859894 TAGAATGTTAAATCAGGACAGGG + Intronic
1170829361 20:19826686-19826708 TAAGAAGTTAAACCAGGATAAGG - Intergenic
1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG + Intronic
1174588814 20:51628945-51628967 CAGGAAGTTAAACCAGGCCTTGG - Intronic
1174764680 20:53241820-53241842 CAAGATGATAATGCAGGACATGG + Intronic
1176105115 20:63382248-63382270 GAGGATGATAAACCAGAAAAGGG + Intergenic
1180306346 22:11128982-11129004 CAGGATCTCAAAACAGCACAGGG + Intergenic
1180544865 22:16491165-16491187 CAGGATCTCAAAACAGCACAGGG + Intergenic
1181839965 22:25648438-25648460 CTAGAGGTTAAACTAGGACAAGG + Intronic
949566701 3:5251894-5251916 CAAGACTTTAAACCATGACAAGG - Intergenic
949786996 3:7752839-7752861 CAGGATGTAATTCCAGGATATGG - Intergenic
951066988 3:18278089-18278111 GAGGATGGTAAACCAGAATAGGG - Intronic
953857108 3:46507884-46507906 CAGGATTTTAAACCAGGGCATGG - Intergenic
955163678 3:56489895-56489917 CAGAATCTTATACCTGGACAGGG + Intergenic
957523320 3:81349251-81349273 TGGGATGTTAAACCAGCAAATGG + Intergenic
960077568 3:113505105-113505127 CAGGATGTAAAACCCAGATATGG - Intronic
961929992 3:130523028-130523050 GAGGATTTTCAACCAGGATAAGG - Intergenic
963042185 3:141078066-141078088 CAGGATTTTAAACCAAGATCTGG - Intronic
964857522 3:161162790-161162812 CAGGATTTTCAATAAGGACACGG + Intronic
965899419 3:173620160-173620182 AAGGATGATAAACCACGATAGGG + Intronic
972961659 4:44460626-44460648 CAGGATATAGAACCAGGAAAGGG - Intergenic
977950657 4:102966585-102966607 CAGGATCTCAAAACAGCACAGGG + Intronic
978326860 4:107567960-107567982 AAGGATGATAAACCATGATAAGG + Intergenic
979163087 4:117488932-117488954 AAGGATGTTCAACCATTACATGG + Intergenic
981925234 4:150131975-150131997 CAGTATGTTAAACCAAGCCTCGG + Intronic
982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG + Intergenic
983717370 4:170799961-170799983 CAGGAAGTTACTCCAGGAGAAGG + Intergenic
983856571 4:172653562-172653584 CAGAATGTTGAACTAAGACAAGG - Intronic
984076996 4:175195674-175195696 CAGGACGTTAAACCAGGAGTGGG + Intergenic
986557395 5:9025445-9025467 CAGGATGCTAATCCAGGGAAGGG + Intergenic
987301934 5:16605190-16605212 GAGGAGGTTAAGGCAGGACAAGG - Intronic
988661035 5:33268838-33268860 CCTGATGTTAAATGAGGACAGGG - Intergenic
990525375 5:56620977-56620999 CTGGAGCTTAATCCAGGACAGGG - Intergenic
992320980 5:75612649-75612671 CAGAATGTTCCACCAGAACAGGG - Intronic
994686016 5:102953269-102953291 CACGATGTAAAAACAGGAGATGG + Intronic
995427271 5:112039368-112039390 CAGGATGGGAGACCAGGGCAGGG + Intergenic
996638060 5:125718690-125718712 CTGGAGGTTGAGCCAGGACATGG - Intergenic
997639641 5:135440235-135440257 GAGGATGTTAAACCATTCCATGG - Intergenic
998525136 5:142835998-142836020 CAGGATTTAAACCCAGGCCAGGG + Intronic
998692408 5:144601221-144601243 CAGGACGTCAAACCTTGACATGG - Intergenic
1000524577 5:162340762-162340784 CAGCATTTTAAACCAAGATATGG + Intergenic
1000813526 5:165891501-165891523 GAGGATGTTACACCTGGAGAGGG + Intergenic
1002296577 5:178234644-178234666 CAGGATTTGAACCCAGGGCATGG + Intergenic
1004021403 6:11779222-11779244 CAGGTTGATAAACCAGATCATGG + Intronic
1005010642 6:21332229-21332251 CAGGATGTAAGAACAGGAGAGGG - Intergenic
1007337918 6:41167976-41167998 CAGGATGTTAGACCAAGGGAAGG + Intergenic
1007450208 6:41936439-41936461 AAGGTTGTGAAACCAGGACTTGG + Intronic
1015507428 6:134003646-134003668 CAGGATGTTTGACTTGGACAAGG - Intronic
1016195355 6:141329832-141329854 AAAGATGATAAACCAGGAAAAGG - Intergenic
1016448279 6:144155007-144155029 CAGGATATTAATCCAAGTCAGGG - Intronic
1021166048 7:17343029-17343051 CTGGATGTCAAATCAGGAAAAGG - Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023870516 7:44260884-44260906 CAGGGTGCTGACCCAGGACATGG - Intronic
1024244906 7:47461972-47461994 CACTATGTAAAAACAGGACAGGG + Intronic
1024570709 7:50721156-50721178 CAGAAAGTAAAACCAGGATAAGG - Intronic
1026418313 7:70206275-70206297 GATGAGGTTAAACCAGGAAAGGG + Intronic
1027222878 7:76225223-76225245 AAGAGTGTTAGACCAGGACAAGG - Intronic
1028332506 7:89611968-89611990 CAGGATGCTAGAGGAGGACATGG - Intergenic
1030176289 7:106659248-106659270 TTGTATGTTAGACCAGGACAGGG + Exonic
1031968493 7:128046007-128046029 CACTATGTGAAACCAGGAAAGGG + Intronic
1034912792 7:155011317-155011339 CAGGAAGTTACTCCAGGTCATGG + Intergenic
1039259972 8:35760910-35760932 CAGGATTTTTAAACTGGACAGGG + Intronic
1039352011 8:36773365-36773387 AAGGATGGTGATCCAGGACAAGG + Intergenic
1040806165 8:51398439-51398461 CAGGAAGTTGAATCAGAACACGG + Intronic
1042072571 8:64952436-64952458 CAGAATGGAAAACCAGGAGATGG + Intergenic
1043970594 8:86524262-86524284 CAGGATTTTCAGCCAGGGCATGG + Intronic
1043993937 8:86789839-86789861 CAGGATGGCAAACCAGGCAAGGG + Intergenic
1044589278 8:93898262-93898284 CAGGTATGTAAACCAGGACAGGG - Intronic
1047360310 8:124162920-124162942 CATGACGTTAAACCAGGTAAAGG + Intergenic
1048479819 8:134778812-134778834 CAGGATTACAAAACAGGACATGG + Intergenic
1054863700 9:69978457-69978479 TAGGATCTGAAACCAGGACTGGG + Intergenic
1055674468 9:78641401-78641423 AAGGATGTAAAAACATGACAAGG + Intergenic
1058629067 9:106967577-106967599 CAGGATTTCAAACCAGGTAAGGG - Intronic
1058780972 9:108334738-108334760 CAGGGTATTGAAACAGGACATGG + Intergenic
1185477895 X:425894-425916 CAGGAGGCTCAGCCAGGACACGG - Intergenic
1185478485 X:429143-429165 CAGGAGGCTCAGCCAGGACACGG - Intergenic
1188973624 X:36647231-36647253 CAGGGTGTGAAAATAGGACAAGG - Intergenic
1195023150 X:100849370-100849392 CAGGTTGTTGAACCAGGAAAAGG + Exonic
1199870899 X:151897785-151897807 CATGAGGTTAAACCTGGAAAGGG - Intergenic
1200240103 X:154488919-154488941 CATGGTGTTAATGCAGGACAAGG - Exonic
1201185727 Y:11400380-11400402 CAGGATCTCAAAACAGCACAGGG + Intergenic
1201896327 Y:18996584-18996606 CAAGAAGCTAAGCCAGGACAAGG + Intergenic