ID: 1168564765

View in Genome Browser
Species Human (GRCh38)
Location 19:57413777-57413799
Sequence TGGGTTCCAAACTCAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168564756_1168564765 15 Left 1168564756 19:57413739-57413761 CCCTTGGGTCCAAGGAGAGCCTG No data
Right 1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1168564758_1168564765 6 Left 1168564758 19:57413748-57413770 CCAAGGAGAGCCTGTAGTTCCAC 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1168564760_1168564765 -4 Left 1168564760 19:57413758-57413780 CCTGTAGTTCCACCAGACCTGGG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1168564757_1168564765 14 Left 1168564757 19:57413740-57413762 CCTTGGGTCCAAGGAGAGCCTGT 0: 1
1: 0
2: 5
3: 19
4: 220
Right 1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1168564753_1168564765 30 Left 1168564753 19:57413724-57413746 CCTTTTCTTCTCTCTCCCTTGGG 0: 1
1: 0
2: 9
3: 102
4: 772
Right 1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168564765 Original CRISPR TGGGTTCCAAACTCAGTGCC TGG Intronic
900615776 1:3565079-3565101 TGGGTTCCAAGCACAGGGCCTGG + Intronic
900717826 1:4156547-4156569 TTGGTTCCAAAGACACTGCCTGG - Intergenic
901082486 1:6591508-6591530 TGGGTGCCCAGCTCAGTGCCTGG + Exonic
901222279 1:7590053-7590075 AAGGATCCAAACTCAGGGCCTGG - Intronic
901415124 1:9111194-9111216 GGGGGGCCAAACTCAATGCCAGG + Intronic
902086182 1:13864493-13864515 TGGAATCCAAAATCAGTGGCCGG - Intergenic
902515612 1:16987938-16987960 TGGGTACCAGGCTCCGTGCCTGG + Intronic
904340249 1:29829607-29829629 TGGGGGACAAACTCAGGGCCTGG + Intergenic
904460276 1:30673061-30673083 TCTGTCCCAAACTCAGCGCCAGG + Intergenic
905349094 1:37332129-37332151 TGTGTGCCAGGCTCAGTGCCAGG - Intergenic
905532085 1:38687876-38687898 TGGGTACTAAGCTCAGTACCGGG - Intergenic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906384990 1:45360384-45360406 AGGTTTCCCAACTGAGTGCCAGG + Intronic
906883010 1:49613273-49613295 TGGGTACCACACTCAGTACCAGG + Intronic
908319871 1:62968735-62968757 TGGGTACCATGCTCAGTACCTGG + Intergenic
909698249 1:78491345-78491367 TCTGGTCCAAACTCAGTGTCAGG - Intronic
910034123 1:82769717-82769739 TGTGTTCCAAACACAGTGGCTGG + Intergenic
911826519 1:102493107-102493129 TGGGTACTATACTCAGTACCTGG + Intergenic
912455031 1:109791505-109791527 TGTGTTCTGAACTCTGTGCCTGG - Intergenic
914262395 1:146010234-146010256 TAGTTTTCAAAATCAGTGCCAGG - Intergenic
914353770 1:146863367-146863389 TGGGTACTAAGCTCAGTACCTGG - Intergenic
916500949 1:165386243-165386265 TGGGTTCCAATCTGAGGGCTTGG - Intergenic
920381567 1:205537381-205537403 ATGGTTCCAGACTCTGTGCCAGG + Intergenic
922412390 1:225389334-225389356 CTGGTTCCAAAGTCTGTGCCAGG + Intronic
1062985158 10:1761577-1761599 TGGGTCCCAGGCTCAGTACCTGG + Intergenic
1063090694 10:2863815-2863837 TGGGTGACTAACCCAGTGCCTGG + Intergenic
1063741868 10:8831958-8831980 AGGCTTCCAAACTAAGTGTCAGG + Intergenic
1064619038 10:17195492-17195514 TGGGTACTATGCTCAGTGCCTGG + Intronic
1064684384 10:17844676-17844698 TGGGTTCTATGCTCACTGCCTGG - Intronic
1065004088 10:21363583-21363605 CCAGTTCCAAGCTCAGTGCCTGG - Intergenic
1067450177 10:46377196-46377218 TGGTTTCCAAAGTCAGTTGCTGG + Intronic
1067526916 10:47044738-47044760 TGGGCTCCAGCCCCAGTGCCAGG + Intergenic
1067587065 10:47482567-47482589 TGGTTTCCAAAGTCAGTTGCTGG - Intronic
1067634125 10:47990334-47990356 TGGTTTCCAAAGTCAGTTGCTGG - Intergenic
1071302830 10:84269686-84269708 TGGATTCCAAACTCAGGTTCTGG - Intergenic
1072577082 10:96710065-96710087 TGGGTGCCAGACCCAGTGTCTGG - Intronic
1072930188 10:99655815-99655837 TAGGCTCCAACCTCAGTCCCAGG - Intergenic
1073474221 10:103742402-103742424 TGGGCACTAAACTCAGTGACAGG - Intronic
1073595155 10:104792195-104792217 TGAATTCAAAACTCAGGGCCTGG + Intronic
1074424408 10:113338401-113338423 TGGGTGCCAAACACTGTGCTAGG + Intergenic
1076136005 10:128046124-128046146 AGGGTGCCAGAGTCAGTGCCAGG + Intronic
1078447874 11:11418353-11418375 TGTGTTCCAAGCACTGTGCCAGG - Intronic
1078474477 11:11619818-11619840 TGGTTTTCAAGCCCAGTGCCAGG + Intronic
1079169693 11:18081090-18081112 TGGGTACTAAGCTCACTGCCTGG - Intronic
1079343413 11:19631688-19631710 TAGGTGCCACACTCAGTGCCGGG - Intronic
1079640560 11:22799842-22799864 TGGGTGCCTAGCACAGTGCCGGG - Intronic
1081623282 11:44631813-44631835 TGAGTGCCTAGCTCAGTGCCTGG + Intergenic
1082747022 11:56975067-56975089 TGGGTACTATACTCACTGCCTGG + Intergenic
1085374116 11:76042513-76042535 TGGGTTCCAGTCTCAGTGCCAGG + Intronic
1086151336 11:83614122-83614144 TGAGTTCCAAATTCAGTGTAGGG + Intronic
1088763883 11:112958326-112958348 TGGATTCTCAACTAAGTGCCTGG - Intergenic
1088879979 11:113965450-113965472 TTGGTTCCAATCTCAGAACCTGG - Intergenic
1089342715 11:117770244-117770266 TGGGTGCCAGGCACAGTGCCAGG - Intronic
1089813860 11:121154781-121154803 TGGGTTCCTAGCCTAGTGCCTGG + Intronic
1089869500 11:121659523-121659545 TTGGTTCCCTACCCAGTGCCTGG + Intergenic
1090059244 11:123449754-123449776 TGTGTTCCAACCTGAGTGCTGGG - Intergenic
1092076587 12:5678429-5678451 TGGCTTCCTAACCCAGAGCCTGG - Intronic
1093110567 12:15146723-15146745 TGGGTCCCATGCTCTGTGCCTGG - Intronic
1093973141 12:25392612-25392634 TGGGTTCCTATCTCAGTTCCTGG + Intergenic
1094045279 12:26159841-26159863 TGAGTACCAAGCCCAGTGCCTGG + Intronic
1096055206 12:48645110-48645132 TGGTTTACAATCTCAGTGCTAGG - Intergenic
1097751695 12:63361869-63361891 TGGGTACTATACTCAGTACCTGG - Intergenic
1098535288 12:71587297-71587319 TAGGTGGAAAACTCAGTGCCAGG - Intergenic
1099432475 12:82604399-82604421 TGGGTACTATGCTCAGTGCCTGG + Intergenic
1101266729 12:103095934-103095956 TGGGTCCCAAACTGTGTGCCAGG + Intergenic
1101574601 12:105985984-105986006 TAGGTTCTAAAATCAGTGCATGG - Intergenic
1102495359 12:113315595-113315617 CGGGTTCCAGGCTAAGTGCCTGG + Intronic
1103921560 12:124402089-124402111 AGAGTTCCAAAGTCATTGCCTGG + Intronic
1106764898 13:32903816-32903838 TTGGATCCACACTCTGTGCCAGG + Intergenic
1107487731 13:40845856-40845878 TGGGTCCTAAGCTCAGTACCTGG + Intergenic
1107510923 13:41083556-41083578 TGGATTCCTAACACAATGCCTGG - Exonic
1108179222 13:47824415-47824437 TGGGTTCTATGCTCACTGCCTGG + Intergenic
1108224653 13:48275764-48275786 TGTGTTTCAAACTCATTGCTGGG - Intergenic
1111735187 13:92129011-92129033 TGGGAGCCAAACTCATTGCAAGG + Intronic
1114528105 14:23378795-23378817 TGGGTTCCAGCCCCAGCGCCTGG + Intronic
1116796981 14:49401927-49401949 TGGGTTCAAAACTCACTGTGAGG - Intergenic
1117345769 14:54830623-54830645 TGGGTACTATGCTCAGTGCCTGG - Intergenic
1117574406 14:57083599-57083621 TGGCCTCCAAACTCAGACCCAGG + Intergenic
1118626625 14:67665151-67665173 TGGGTTCAAAAGTCAGGGCTTGG - Intronic
1120517862 14:85491466-85491488 TGGGTACTAAACTTAGTGCCTGG + Intergenic
1121897358 14:97660896-97660918 TTGGAGCCCAACTCAGTGCCTGG - Intergenic
1122321227 14:100856980-100857002 TGGGTGCCCAACACAGTGCCTGG + Intergenic
1123873676 15:24601710-24601732 TGGGTACCACACTTATTGCCAGG - Intergenic
1128551589 15:68601225-68601247 TGAGTGCCAAGCTCTGTGCCAGG + Intronic
1129062543 15:72871834-72871856 TGGGGTTTAAACTCAGTGGCAGG + Intergenic
1132454670 16:15793-15815 TGGTTGCCGAAGTCAGTGCCCGG - Intronic
1132682898 16:1150905-1150927 CAGTTTCCAAACTAAGTGCCAGG - Intergenic
1134128359 16:11631754-11631776 TGGGTTCTAAACCCAATGACGGG - Intronic
1135006779 16:18831377-18831399 TGGGTAACAAACTTTGTGCCTGG - Intronic
1135161122 16:20097276-20097298 TGGGTACCAAGCTCAGTACCTGG - Intergenic
1135725808 16:24853194-24853216 TGGGTGCCAAGCTCTGTGCTAGG - Intronic
1136121403 16:28137817-28137839 TGGGTACTATGCTCAGTGCCTGG - Intronic
1136293261 16:29288394-29288416 TGGCTTCCAAACCAAGTGGCTGG + Intergenic
1137310788 16:47255693-47255715 TGGGTGCCTAACACAGGGCCTGG - Intronic
1137476894 16:48817121-48817143 TGGGTTCAACCCTCCGTGCCTGG + Intergenic
1137871299 16:51953067-51953089 TAGGTGCCAGACTCCGTGCCAGG + Intergenic
1139824387 16:69745606-69745628 TTGGTTCTGCACTCAGTGCCCGG - Intronic
1139980250 16:70852154-70852176 TGGGTACTAAGCTCAGTACCTGG + Intronic
1140648099 16:77056040-77056062 TGGGTACAAAGCTCAGTACCTGG + Intergenic
1142099145 16:88262401-88262423 TGGCTTCCAAACCAAGTGGCTGG + Intergenic
1143299598 17:5899791-5899813 TGGGTCCCAAAGTCAGGACCAGG - Intronic
1143471828 17:7180080-7180102 TGGGGCCCGAACGCAGTGCCTGG - Intergenic
1146616543 17:34361429-34361451 TGGGTTCCAAATCCAGGGGCAGG + Intronic
1148573242 17:48687836-48687858 GGGGTACCAAACTCCCTGCCAGG - Intergenic
1149165711 17:53749581-53749603 TGGTTTCCACATTCAGTCCCTGG - Intergenic
1150562973 17:66311029-66311051 TGGTTTTCAAAGTTAGTGCCAGG + Intronic
1151458776 17:74242337-74242359 CTGGTGCCAAGCTCAGTGCCTGG + Intronic
1152001154 17:77646028-77646050 TGGGATCCCATCTCTGTGCCTGG - Intergenic
1152102164 17:78308382-78308404 TGGGTGCCAAACTCACTCCCAGG + Intergenic
1152458783 17:80430714-80430736 TGGGTGCCAGGCTCTGTGCCCGG + Intronic
1152912180 17:83011129-83011151 TGGTTTCCCACCTCTGTGCCTGG - Intronic
1156583198 18:38403238-38403260 TGGGTACTAAGCTCAGTACCTGG - Intergenic
1156603511 18:38638785-38638807 TGGGTTCCATGCTCACTTCCTGG + Intergenic
1156704572 18:39864106-39864128 AGAACTCCAAACTCAGTGCCAGG + Intergenic
1157779118 18:50421389-50421411 TTGGTTCCAATCTAAGTACCTGG + Intergenic
1158956808 18:62547966-62547988 AGGGTTCCTAAAACAGTGCCTGG + Intronic
1160526316 18:79540439-79540461 TGGGTTCCAGCCCCAGTGCAGGG - Intergenic
1161576850 19:5059116-5059138 TGGGTTCTGAGCTCAGGGCCTGG + Intronic
1162193480 19:8965468-8965490 TGGTTTCCAAAGTGAGTTCCTGG + Exonic
1162762435 19:12896683-12896705 TGGGTTCGATGCTCAGAGCCAGG - Intronic
1164473381 19:28554351-28554373 TGGATTCCAACTTCAGAGCCTGG - Intergenic
1164573227 19:29388919-29388941 TGGGTACCATACTCACTACCTGG + Intergenic
1165125648 19:33594974-33594996 TGGGATCCAAACTTATTGACTGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
1167577464 19:50324710-50324732 TTGGCTCCAAACACAGTGCTTGG + Intronic
1167755095 19:51407798-51407820 TGGGATTCAAACTCAGGCCCAGG - Intergenic
1168055578 19:53862903-53862925 TCAGATCAAAACTCAGTGCCGGG + Intergenic
1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG + Intronic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
926350300 2:11987889-11987911 TGAGTGCCAAACCCTGTGCCAGG + Intergenic
926892080 2:17647552-17647574 TTAGTTCAAAACTCAGCGCCTGG + Intronic
926921541 2:17945510-17945532 TGGGTGCCAGATGCAGTGCCAGG + Intronic
927857612 2:26537265-26537287 GGGGCTCCTACCTCAGTGCCCGG + Intronic
928338566 2:30421357-30421379 TGAATACCAAACTCAGAGCCAGG - Intergenic
929544820 2:42848949-42848971 TGGATTCCAAAGTCAGTTCAGGG - Intergenic
929610993 2:43270521-43270543 TGGGTTCTAAACTAGATGCCAGG + Intronic
930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG + Intergenic
932314715 2:70772254-70772276 AGGGCTCCAATCTCAGTCCCAGG + Intergenic
933593338 2:84257658-84257680 TGTGTACCAGACTCAGTGCTAGG - Intergenic
934082131 2:88477816-88477838 TGGGTACTATACTCAGTACCTGG - Intergenic
938115674 2:128601731-128601753 TGTGTTCCAGGCTCAGTGTCTGG + Intergenic
940141239 2:150493338-150493360 TGATTTTCAAATTCAGTGCCAGG - Intronic
941046050 2:160676983-160677005 TGGGTTCCAAAATGACTTCCAGG - Intergenic
941127275 2:161599413-161599435 TGGGTACTATACTCAGTACCTGG + Intronic
941338113 2:164269582-164269604 TGGGTACTATACTCAGTACCTGG - Intergenic
942835186 2:180287043-180287065 TGGGTACCATGTTCAGTGCCTGG + Intergenic
943410535 2:187541405-187541427 TAGGCTCCCAAGTCAGTGCCAGG - Intronic
945193254 2:207212403-207212425 TGGGTACCATGCTCAGTACCTGG + Intergenic
945470603 2:210224701-210224723 TGGGACCCGGACTCAGTGCCCGG - Intronic
946415121 2:219536380-219536402 TGGGTGCCAGGCTCAGTGCTGGG + Intronic
947549542 2:231036936-231036958 TGGGTTTCAACCCCAGCGCCTGG + Intergenic
947559563 2:231136255-231136277 GGACCTCCAAACTCAGTGCCTGG + Intronic
948094950 2:235325888-235325910 TGGGGTCAAAACCCAGTGACTGG + Intergenic
948557107 2:238820635-238820657 TGGGTACTAAGCTCAGTACCTGG + Intergenic
1168799586 20:635559-635581 TGGATTCCAGACTCAGGACCTGG + Intergenic
1168852816 20:988248-988270 TGGCTTCCCAACTCACTTCCAGG - Intronic
1170605899 20:17874962-17874984 TGGTTTCCCCACACAGTGCCTGG - Intergenic
1172495245 20:35377523-35377545 TGAGTACATAACTCAGTGCCTGG + Intronic
1173214032 20:41063043-41063065 TGGGTTCTATGCTCAGTACCTGG - Intronic
1173671437 20:44801826-44801848 TGGGTACCAAATTCAGTCCTGGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1175303489 20:57959711-57959733 TGGGTCCTAAATTCAGTGACTGG + Intergenic
1175357009 20:58376476-58376498 TTGGTCCCAATCTCTGTGCCTGG - Intergenic
1177957228 21:27613890-27613912 TGGGTACTAAGCTCAGTACCTGG - Intergenic
1179466481 21:41578832-41578854 TGGGATCCCAACTCAGTTTCAGG + Intergenic
1179709336 21:43203955-43203977 TGGCTTCCCAACTCCGTGTCTGG + Intergenic
1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG + Intergenic
1182431723 22:30302728-30302750 TGGGCTCTAACCACAGTGCCAGG + Intronic
1183348293 22:37319796-37319818 TGGGTTCCAATCCCAGTGTGTGG + Intergenic
1183441582 22:37825785-37825807 TTGGTTCCAAGCTCAGTCCTAGG + Intergenic
1184512951 22:44943680-44943702 TGGGGTCCACATTCAGTGGCCGG + Intronic
951325469 3:21297210-21297232 AGGTTTCCAAACTCCATGCCTGG + Intergenic
954329218 3:49880639-49880661 TGGGTGCCATGCTCAGGGCCAGG + Intergenic
956341177 3:68225600-68225622 TGGGTACCTGACTCAGGGCCTGG - Intronic
956681837 3:71788261-71788283 TGGGTTCTAAATTCAATGGCTGG + Intergenic
956869387 3:73401907-73401929 TTGTTTCAAAACTAAGTGCCTGG - Intronic
957573185 3:81975347-81975369 TTGGTCCCAAGCGCAGTGCCTGG - Intergenic
960688622 3:120319788-120319810 TGGGTACTAAACTTAGTACCTGG + Intergenic
962443629 3:135445817-135445839 GAGGTGCCCAACTCAGTGCCTGG + Intergenic
964434427 3:156636736-156636758 GGGGTTCAAACCTCATTGCCTGG - Intergenic
965641714 3:170835924-170835946 TAGGTTTCAAACTCAGAGGCAGG - Intronic
966632803 3:182097127-182097149 TGGGTTCCAGACACTGTTCCAGG - Intergenic
968714146 4:2141897-2141919 TGGGTTAGAAACTCAGAGCGTGG - Intronic
969870944 4:10104423-10104445 TGGACCCCAAACTCAGCGCCTGG + Intronic
970413842 4:15837172-15837194 TGCGTTCCCCACTCAGTCCCTGG + Intronic
971095929 4:23403198-23403220 TGGGTTCTATGCTCAGTACCTGG - Intergenic
972346322 4:38195499-38195521 TGAGTACCAAGCTCAGTGCCAGG - Intergenic
972920998 4:43941654-43941676 TGGGTACTATACTCAGTACCTGG - Intergenic
974239755 4:59231612-59231634 TGGGTACTAGACTCAGTACCTGG - Intergenic
976153621 4:82118702-82118724 TGGGTACTATGCTCAGTGCCTGG + Intergenic
976279569 4:83313797-83313819 TGGTTTCCAAACTCTGTGCAAGG + Intronic
977517763 4:98043868-98043890 TGGGTACTAGACTTAGTGCCTGG - Intronic
978575667 4:110187752-110187774 TGGGTTCCCTACTATGTGCCAGG - Intronic
980302967 4:131017761-131017783 TGGGTACTAATCTCAGTACCTGG - Intergenic
980728139 4:136791511-136791533 TGGGTACTATGCTCAGTGCCTGG + Intergenic
981181394 4:141750015-141750037 TGGGTTCTAATCTTAGTACCTGG + Intergenic
981410529 4:144425081-144425103 TGCATTCCTAGCTCAGTGCCTGG + Intergenic
981410573 4:144425551-144425573 TGAGTTCCTAGCTCAGTGCCTGG - Intergenic
981674241 4:147322870-147322892 TGGGTACTAAGCTCAGTACCTGG + Intergenic
982325306 4:154123784-154123806 TGGGTTCCAAAGAAACTGCCAGG + Intergenic
985549320 5:525008-525030 TGGGCTCCCATCTCAGAGCCTGG - Intergenic
987145200 5:14984919-14984941 GGGGTTCTAAACTCTGTGACTGG + Intergenic
987419816 5:17706091-17706113 AGGGTTCCTTACCCAGTGCCTGG + Intergenic
988195447 5:27999456-27999478 TGGGTACCATGCTCAGTGCCTGG - Intergenic
988395742 5:30695922-30695944 TGGGTTCCAGACACTGTGCATGG + Intergenic
988455559 5:31384247-31384269 TGGGCTCCTAGCACAGTGCCTGG - Intergenic
989215620 5:38901744-38901766 AGGGTTCTAAAAGCAGTGCCTGG + Intronic
990070105 5:51771830-51771852 TTGGTTACAAACTCAGTGATGGG + Intergenic
990612950 5:57477496-57477518 TGGGTACTATACTCAGTACCTGG + Intergenic
991407472 5:66315282-66315304 TGGGTAACAAGCTCAGTACCTGG - Intergenic
991660019 5:68941839-68941861 TGGGTACCATGCTCAGTACCTGG + Intergenic
992206475 5:74435091-74435113 TGGGCTCCAAACCCCATGCCAGG - Intergenic
992561549 5:77957756-77957778 TTGGTCCCAAACCCAGCGCCGGG + Intergenic
993110152 5:83646749-83646771 TGGGTTCCCAGCTCAGTGCCTGG - Intronic
995446710 5:112252730-112252752 TGGGTACTAAGCTCACTGCCTGG + Intronic
996895983 5:128483200-128483222 TGGGTACCACGCTCAGTACCTGG + Intronic
997440568 5:133906023-133906045 TGGGTCCCCAAATCACTGCCTGG + Intergenic
998731860 5:145087091-145087113 TGGGTACCACACTCAGTACCTGG - Intergenic
998881986 5:146654144-146654166 GGGGTTCTAAACTCAGTGACTGG - Intronic
999583100 5:153061616-153061638 TGGGATTCAAACTTAGTGCCTGG - Intergenic
1001284942 5:170416047-170416069 AGGGGTGCAAACTCAGTTCCAGG + Intronic
1003396172 6:5754120-5754142 TGAGATCCTAACACAGTGCCTGG - Intronic
1004008837 6:11661653-11661675 TGGGTACCATGCTCAGTACCTGG - Intergenic
1005141392 6:22635800-22635822 TGGGTTCCTATTTCAGAGCCTGG + Intergenic
1006520250 6:34567145-34567167 TGGGGTCCACACGCAATGCCAGG + Intergenic
1007448982 6:41928878-41928900 AAAGTCCCAAACTCAGTGCCTGG + Intronic
1007740406 6:44006287-44006309 TTGGGTCCAAAGTCACTGCCTGG + Intergenic
1010162557 6:72874664-72874686 TAGGTACCAAGCACAGTGCCAGG - Intronic
1010720275 6:79275773-79275795 TTAGTTCCTAACTCAATGCCTGG - Intergenic
1015701371 6:136038996-136039018 TGCATGCCAAACTCAGTGCTGGG - Intronic
1019073285 6:169367114-169367136 TGGGTGCCGTGCTCAGTGCCTGG - Intergenic
1019445379 7:1068260-1068282 TGGGTTCCAGCCTCCGTGCCAGG - Intronic
1019611125 7:1937206-1937228 AGAATTCCACACTCAGTGCCCGG + Intronic
1020605277 7:10329409-10329431 TGGGGTACAAACAAAGTGCCAGG - Intergenic
1021734145 7:23626603-23626625 TGGGTACCAAGCTCAGTACCTGG - Intronic
1022042214 7:26591956-26591978 TGGGTTTCAAACTCAGAGACAGG + Intergenic
1023677451 7:42645157-42645179 TGGGTTGCAATCTCAATGCTTGG - Intergenic
1023975822 7:45029053-45029075 GAGGCACCAAACTCAGTGCCTGG - Intronic
1024635568 7:51287133-51287155 TGGGTACCACACTCACTACCTGG + Intronic
1024702169 7:51915880-51915902 TGGGTACCATGCTCAGTACCTGG + Intergenic
1026602929 7:71791597-71791619 TGGGTTCTAGGCTTAGTGCCTGG + Intronic
1028475442 7:91248574-91248596 TGAGTACCAAACAGAGTGCCTGG + Intergenic
1028699999 7:93766318-93766340 TGGGTACTATACTCAGTACCTGG + Intronic
1028713867 7:93941518-93941540 TGGGTACCATGCTCAGTACCTGG - Intergenic
1030109746 7:106016903-106016925 TGGGTTACAAACTTAGTGCTGGG + Intronic
1033136085 7:138785605-138785627 TGGGTGGCAGAGTCAGTGCCTGG - Intronic
1033932019 7:146535713-146535735 TGGGTACCATACTCACTACCTGG - Intronic
1034094375 7:148392899-148392921 TGAGTTCCTAGCTCAGTGCTGGG - Intronic
1035475796 7:159143613-159143635 TGGAGCCCAAAGTCAGTGCCTGG - Intronic
1036495123 8:9263297-9263319 TGGGTACCATGCTCAGTACCTGG + Intergenic
1037543502 8:19895050-19895072 TGGGTTCCAAAGCCATTTCCTGG + Intergenic
1037961488 8:23101780-23101802 TCTGATCCGAACTCAGTGCCTGG + Intronic
1039389131 8:37163025-37163047 CTGGCTCCAAACCCAGTGCCCGG + Intergenic
1043383116 8:79723695-79723717 TGGGTTCAAGCCTCAGTCCCTGG - Intergenic
1045359978 8:101424162-101424184 TGGGTCCCAAACTCTGGGCCCGG + Intergenic
1047345030 8:124019505-124019527 TGGGCTCCAAGCATAGTGCCTGG + Intronic
1047790967 8:128203224-128203246 TCAGTTCCTAACACAGTGCCTGG + Intergenic
1048197375 8:132343264-132343286 TGTGTTCCAGACCCTGTGCCAGG + Intronic
1048201137 8:132374621-132374643 TGGGTACTAAACTTAGTACCTGG - Intronic
1048347603 8:133588643-133588665 TGGTATCCAAAATCAGTGGCAGG - Intergenic
1048749952 8:137661658-137661680 TGGGTTCCAGACTGAGCGCATGG - Intergenic
1049157938 8:141078331-141078353 TGGGCCCCAAACCCAGTGGCTGG - Intergenic
1049884090 9:16221-16243 TGGTTGCCGAAGTCAGTGCCCGG - Intergenic
1051222125 9:14859933-14859955 TGGGTGCCCAGCTCAGTGCTTGG + Intronic
1053139450 9:35673695-35673717 TGGGTTCCAAGCTGAGTCCATGG + Intronic
1053729789 9:41041741-41041763 TGGGTTTCAGCCTCATTGCCTGG - Intergenic
1054698719 9:68390322-68390344 TGGGTTTCAGCCTCATTGCCTGG + Intronic
1054796201 9:69304592-69304614 TGGGTACTATACTCAGTACCAGG - Intergenic
1056085430 9:83144224-83144246 TGGGTACCACTCTCACTGCCTGG + Intergenic
1056112575 9:83410249-83410271 TGGGTACTATACTCAGTACCTGG - Intronic
1057492949 9:95536655-95536677 TGGGTTCTAGACTTAGTACCAGG + Intergenic
1057510218 9:95672347-95672369 TGGGTTCTATGCTCAGTACCTGG + Intergenic
1057588511 9:96350492-96350514 TGGGTTCAAAACTTAGCTCCAGG - Intronic
1058552014 9:106124732-106124754 TGGCTTCCAGGCTCAGTGTCAGG + Intergenic
1060151616 9:121292532-121292554 TGTGTGCCAAACACAGTGCCAGG + Intronic
1060915008 9:127383182-127383204 TGGCTTTAAAGCTCAGTGCCTGG + Intronic
1061166678 9:128926892-128926914 TGGGTGCCAGACTCCATGCCTGG + Intronic
1061222258 9:129258926-129258948 GGGGTTAGAAACTCAGGGCCGGG - Intergenic
1062142747 9:134968817-134968839 TCGGTTCCAAAAACAGTCCCTGG + Intergenic
1062308981 9:135925666-135925688 AGGCCTCCAAACTCAGTCCCAGG - Intergenic
1062529410 9:136993303-136993325 TGGGAACCCCACTCAGTGCCAGG - Intronic
1185585539 X:1239906-1239928 TGGGTTCCAACGTCACGGCCAGG + Intergenic
1186350715 X:8736151-8736173 TGAGTTCCAGCCTCAGTGACAGG + Intergenic
1186386221 X:9112820-9112842 TGGGTACCATGCTCAGTGTCTGG - Intronic
1188676106 X:32941696-32941718 TGGGTACTATACTCAGTACCTGG + Intronic
1189805795 X:44734395-44734417 TGGGTTATAAACTAAATGCCAGG + Intergenic
1190051700 X:47155174-47155196 TGGGTTCCAAGCTGAGTTCGTGG + Intronic
1193263981 X:79445823-79445845 TGGGTACTAGACTCAGTGCCTGG + Intergenic
1196034414 X:111128415-111128437 TGGGTGCCAAGCTATGTGCCAGG + Intronic
1196541582 X:116916833-116916855 TGGGTACCAAGCTTAGTACCTGG - Intergenic
1196766484 X:119250194-119250216 TGGGTTTGAAACTCATTGCCAGG - Intergenic
1197174875 X:123474838-123474860 TGGATTCCAGGCTCAGTTCCTGG - Intronic
1198567272 X:137917071-137917093 AGGGATCCAGACTGAGTGCCTGG + Intergenic
1199304800 X:146255014-146255036 TGGGTACCATGCTCAGTACCTGG + Intergenic
1199855821 X:151758097-151758119 TGGGTGCCAAGCACAGTGCCAGG - Intergenic
1200860675 Y:7988549-7988571 TGGGTGCCAGACTGGGTGCCTGG - Intergenic