ID: 1168565301

View in Genome Browser
Species Human (GRCh38)
Location 19:57417354-57417376
Sequence AGGGACTATCCCTCCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168565301 Original CRISPR AGGGACTATCCCTCCTTTTG TGG Intronic
902676967 1:18015510-18015532 AGGGTCTAGCCCTTCTCTTGTGG + Intergenic
903354828 1:22740326-22740348 TGGGACAATTCTTCCTTTTGTGG + Intronic
905884303 1:41483545-41483567 AGGGACTATCCTGCCTTATGGGG + Intronic
906685801 1:47762454-47762476 AAGGACTTTCCCTCCTCTTTGGG + Exonic
907730851 1:57064001-57064023 AGGCACTATGCCTGCTCTTGAGG - Intronic
907998378 1:59655809-59655831 AGGTATTATCCCTTTTTTTGTGG + Intronic
909613697 1:77581834-77581856 AGGGACTCTCCATCCTTCTTAGG + Exonic
910228948 1:84966573-84966595 AAGGACTATGACTCCTTTTTTGG + Intronic
912326475 1:108768108-108768130 AGAGAATCTCCCTCCTTTTGTGG - Intronic
913274250 1:117122027-117122049 AGGGACTGTCCCTCTCTCTGTGG + Intronic
918437820 1:184534694-184534716 AGACACGATCCCTCCCTTTGAGG + Intronic
920647677 1:207815403-207815425 TGGGACTCTCCCTAATTTTGGGG - Intergenic
1064147999 10:12840636-12840658 TGGGTCTTTCCCTGCTTTTGGGG - Intergenic
1067744757 10:48927347-48927369 TAGGAATATCCCTCCTATTGTGG + Intronic
1073012797 10:100374296-100374318 CGTGACTATCCCAGCTTTTGAGG - Intergenic
1074056268 10:109924914-109924936 AGCCACCATCCCTGCTTTTGAGG - Intergenic
1076363771 10:129909216-129909238 AGGGCCTATCCCTCCATGTCTGG - Intronic
1076814416 10:132907783-132907805 AGGGACTAACCCTGTTTGTGAGG - Intronic
1078367269 11:10717066-10717088 AGAGACTATCCCTTCTTGTCTGG + Intergenic
1078751996 11:14174137-14174159 ATAGTCTTTCCCTCCTTTTGGGG - Intronic
1083310988 11:61783700-61783722 AGGGGCTACCCTTCCTTATGGGG - Intronic
1084301946 11:68257934-68257956 AGGGACGAGAGCTCCTTTTGGGG + Intergenic
1088015946 11:105060279-105060301 AGGGACTACCTTGCCTTTTGTGG - Intronic
1088616279 11:111632355-111632377 AGGGACTTCCCTTGCTTTTGGGG + Intronic
1092655880 12:10685023-10685045 AAGGACTTTACCTCCTTTTTTGG - Intergenic
1107460747 13:40599688-40599710 AGGGGCACTCCCTCCCTTTGAGG - Intronic
1107946647 13:45422793-45422815 AGGGAGTATCCCTGTGTTTGGGG - Intergenic
1121788678 14:96682342-96682364 AGGGTCTGTCCCTCTTTTTCTGG - Intergenic
1122993785 14:105251546-105251568 AGGGGCCATCCCTCTTTTCGGGG - Intronic
1125774949 15:42204030-42204052 AGGGCCTAGCCCTCCTTCTCAGG - Intronic
1129488577 15:75902180-75902202 AGGGACTATGCCTGCTTGTCTGG - Intergenic
1133335538 16:5004532-5004554 AAGGACATTCCCTCCTCTTGGGG - Intronic
1134687550 16:16169446-16169468 AGGGCACATCCCTCCTTTTCTGG - Intronic
1137522527 16:49207030-49207052 AGGGACTATCCTCCCTTTCATGG - Intergenic
1137743253 16:50801414-50801436 AAGGACAATCCCTCCATTTGTGG - Exonic
1145050953 17:19660140-19660162 AGGGCCTCTGCCTCCCTTTGAGG + Intronic
1146328385 17:31906334-31906356 AGGTACTATCTCTCTTTTTGAGG - Intergenic
1147776378 17:42904590-42904612 AGGGACCTTCCCTAGTTTTGGGG - Intronic
1149562222 17:57616378-57616400 GGGGACTTTTCCTTCTTTTGAGG - Intronic
1150460653 17:65347547-65347569 CGGGACTATCCCTCCTCTGAGGG - Intergenic
1152775290 17:82197708-82197730 AGAGACTAGCCCTCCTCCTGTGG + Intronic
1153807614 18:8723032-8723054 AGGGATCAGCCCTCCCTTTGTGG + Intronic
1158016329 18:52788846-52788868 ATAGGCTCTCCCTCCTTTTGGGG - Intronic
1158899208 18:61947178-61947200 AGGGACTATGCCTCCACATGTGG + Intergenic
1160962052 19:1726383-1726405 AGGAACGGTCCCTCCTTATGGGG - Intergenic
1168565301 19:57417354-57417376 AGGGACTATCCCTCCTTTTGTGG + Intronic
926141925 2:10372951-10372973 AGGGCTGATCCCTCCTTCTGGGG - Intronic
926692586 2:15747826-15747848 AGGGATTAGCCCTACTTTTCCGG + Intergenic
926801663 2:16665351-16665373 GGGGGCCATCCCTCCCTTTGGGG + Intronic
927939653 2:27095545-27095567 AGGGGCTATCCCTCCCTTCAGGG + Intronic
931537776 2:63298197-63298219 GGGGCCTATCCCTCCCCTTGGGG - Intronic
933751022 2:85602286-85602308 AGGGAGTTACCCTCCTTCTGAGG + Exonic
938807606 2:134821435-134821457 AGGGATCATCTCTCCTTTTGAGG - Intergenic
940851245 2:158689959-158689981 AGGGCCCTTCCCTCCCTTTGAGG - Intergenic
942090871 2:172489626-172489648 AGGGAGTTTATCTCCTTTTGTGG - Exonic
943196021 2:184750992-184751014 GGGGAATATCCTTCCATTTGTGG - Intronic
1169998890 20:11592780-11592802 AAGGACTATGACACCTTTTGGGG + Intergenic
1173315272 20:41937496-41937518 AGGGCTTATCCCTGCTGTTGGGG + Intergenic
1174259454 20:49283218-49283240 AGGGTCTATCCCTAATGTTGCGG + Intergenic
1174718898 20:52789723-52789745 AGGGACTATCCCTTTATATGGGG + Intergenic
1177561116 21:22755561-22755583 AGGGAAAAGCCCTCATTTTGGGG + Intergenic
1178097212 21:29229182-29229204 AGTGACTATCTCAGCTTTTGGGG - Intronic
1178326031 21:31646221-31646243 AGTGTCTATCCTTCCTTATGTGG - Intergenic
1180976052 22:19849019-19849041 AGGCCCCATCCCCCCTTTTGTGG - Exonic
1181446450 22:22978947-22978969 ATAGAATCTCCCTCCTTTTGGGG + Intergenic
1184050274 22:41998965-41998987 AGGGACTTTGCCGCCTTTTTTGG + Intronic
1184779799 22:46641679-46641701 GGGGACTATCCCTCTGTTGGTGG + Intronic
949649064 3:6133812-6133834 AGTGCCTATCCCTCTCTTTGGGG - Intergenic
953482379 3:43262558-43262580 AGGCACCATCCCTGCCTTTGTGG - Intergenic
954996457 3:54886134-54886156 AGGGTCTGTTCCTGCTTTTGAGG - Intronic
956129742 3:66041656-66041678 AGGTACTACTCCTTCTTTTGGGG - Intergenic
961253834 3:125528901-125528923 AGGAACTATAACTCATTTTGAGG + Exonic
961551982 3:127674543-127674565 AGGTACTATGCCTGCTTGTGTGG + Exonic
962385599 3:134929932-134929954 GAGGACTTTCCCTCCTTTTTGGG - Intronic
965138587 3:164806597-164806619 ATCGACTCTCCCTCCTTTTTTGG - Intergenic
969518208 4:7660500-7660522 TGGGACTCTGCCTCCTTTGGGGG - Intronic
971837633 4:31788672-31788694 TTGGAATGTCCCTCCTTTTGTGG + Intergenic
975208110 4:71667558-71667580 AGGGACAATCACTCCTCTTAAGG + Intergenic
976825964 4:89260532-89260554 AGGAAATATCAATCCTTTTGAGG + Intronic
979073807 4:116244742-116244764 AGGGGCTTTTCCTCCTTTTCTGG + Intergenic
985225927 4:187761925-187761947 AAGGACTTTACCTCCTTTTCTGG - Intergenic
987580984 5:19792197-19792219 AGGCACTATCTCATCTTTTGAGG + Intronic
990431141 5:55736901-55736923 AGGGATTTTACCTGCTTTTGGGG + Intronic
995974382 5:118014075-118014097 ATGGCATATCCCTCCTTTTTAGG + Intergenic
997064330 5:130544342-130544364 AGGGACCATCCCTGCTTGGGTGG + Intergenic
997267217 5:132501836-132501858 AGGGACAAATCCTCTTTTTGGGG - Intergenic
998696187 5:144642334-144642356 AGGGACTCTCATTCCATTTGGGG + Intergenic
1001656677 5:173356114-173356136 AGAGGCCATCCCTCTTTTTGAGG - Intergenic
1001689161 5:173619679-173619701 ATGGACAATCCCTGCCTTTGTGG - Intergenic
1004165498 6:13253157-13253179 AGGGCCAATCTCTCATTTTGGGG - Intronic
1005306674 6:24520816-24520838 AGGGACTGTACCTTATTTTGGGG - Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006736084 6:36273521-36273543 AGGGATTCTCTCTCCTTTTCCGG + Intronic
1008363908 6:50653391-50653413 AAAGAGCATCCCTCCTTTTGTGG + Intergenic
1012142679 6:95643146-95643168 AGGGAGAATCCTTCCTTTTCTGG - Intergenic
1015904739 6:138105958-138105980 GGGGACCATGCTTCCTTTTGTGG + Intronic
1022476371 7:30713242-30713264 AGCCACTAGCCCTCCTTTGGAGG - Intronic
1025798472 7:64761499-64761521 AGGAAATATCTCTCCTTTTATGG + Intergenic
1032367467 7:131313928-131313950 ATGGAGTTTCCCTCTTTTTGGGG - Intronic
1035989978 8:4478974-4478996 AGGAATTATCGTTCCTTTTGGGG - Intronic
1039610190 8:38913528-38913550 AAGGACTATCGCTACTCTTGAGG - Intronic
1042472124 8:69202513-69202535 ATGGAGTATCCTACCTTTTGAGG - Intergenic
1043327169 8:79066724-79066746 ATGGAATATCCCTCCATTTGTGG - Intergenic
1046556351 8:115777926-115777948 AGGTACTATTCCTTCTTATGTGG + Intronic
1046844352 8:118899469-118899491 AGAGAATATCCCTGCCTTTGAGG + Intergenic
1047342657 8:123998357-123998379 AGAGAGTTTCCCTCTTTTTGAGG - Intronic
1048405594 8:134116951-134116973 ATGGACTTTCCCTCCTTGGGGGG - Intergenic
1050621953 9:7463085-7463107 AGGGTCTGTCTCTGCTTTTGTGG + Intergenic
1051253561 9:15187831-15187853 AGGCACATTTCCTCCTTTTGTGG + Intronic
1052651441 9:31308171-31308193 AGGGACTATCTTTCCTTCTTTGG + Intergenic
1053315023 9:37043690-37043712 AGTCACTATGCCTGCTTTTGTGG + Intergenic
1056615097 9:88159027-88159049 AGGTCCTATTCCTGCTTTTGTGG + Intergenic
1188610844 X:32095500-32095522 AGGCATTATCCATCCCTTTGGGG - Intronic
1188779758 X:34267299-34267321 AGGCACTATTCCACCTTTTTGGG - Intergenic
1193791141 X:85816235-85816257 ATGGTATCTCCCTCCTTTTGGGG + Intergenic
1195196948 X:102507337-102507359 AGGGACACCCCCTCCTTTTCTGG + Intergenic
1197964385 X:132042307-132042329 AGGGAATACCACTCATTTTGGGG - Intergenic