ID: 1168567351

View in Genome Browser
Species Human (GRCh38)
Location 19:57435934-57435956
Sequence CAGAGTTAGAAGTTTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168567340_1168567351 30 Left 1168567340 19:57435881-57435903 CCGCAGAGAGCCATAGAGGGCTG 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG 0: 1
1: 0
2: 1
3: 25
4: 256
1168567343_1168567351 20 Left 1168567343 19:57435891-57435913 CCATAGAGGGCTGTGCAGGGAGG 0: 1
1: 0
2: 5
3: 40
4: 334
Right 1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG 0: 1
1: 0
2: 1
3: 25
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168567351 Original CRISPR CAGAGTTAGAAGTTTAAAGT TGG Intronic
901544417 1:9944709-9944731 CATAGTTAGAAGTTTATCCTGGG - Intronic
902548522 1:17205551-17205573 CAGAGTTAGAAATCTAAGGCTGG - Intronic
903353765 1:22733955-22733977 CAGAGCTAGAAGTTGAACCTGGG + Intronic
905741817 1:40377713-40377735 CTGAGCTAGAAGTTAAAACTTGG - Intronic
905957521 1:42011431-42011453 CAAAGTTAGAAGTTAAATCTAGG + Intronic
906553833 1:46690862-46690884 CAGAATTTCAAGTTTAAATTGGG - Intronic
908301290 1:62762869-62762891 CAGAGTTAGAAATTTGAGCTGGG + Intergenic
908690150 1:66770501-66770523 CCAATTTAGAAGTTTAAAATAGG - Intronic
908806794 1:67940085-67940107 CAGAGTTTCTAGTTTAAAGCTGG + Intergenic
909516154 1:76509638-76509660 CGAAGTTAGAAGTCTAAAATGGG + Intronic
909539660 1:76776970-76776992 CTCAGTTAAAAGTTTAATGTAGG + Intergenic
909716496 1:78713803-78713825 CAGGGTTAGGAGTAAAAAGTTGG + Intergenic
910378478 1:86599367-86599389 CAGAGTTACAAGTTTTTAATTGG - Intergenic
912158411 1:106950800-106950822 CAGAGTTACAATTTTAAGCTTGG - Intergenic
912166984 1:107053615-107053637 CACAGTGAGATGTTTTAAGTAGG - Intergenic
915070178 1:153260183-153260205 CAGAGTTAGAAGTTCTGAGAGGG + Intronic
918099844 1:181363912-181363934 CAGAGTTAGAAGTCTGAACTTGG + Intergenic
918328157 1:183430085-183430107 GAGATTTAGCAGGTTAAAGTAGG + Intergenic
918992419 1:191714851-191714873 TAGACATAGAACTTTAAAGTGGG + Intergenic
919048043 1:192478592-192478614 CAGAGTTAGAAATTAAAATTAGG - Intergenic
919406855 1:197195978-197196000 CCAAGTTAGAAGCTTAAAGAAGG + Intronic
921655896 1:217737123-217737145 CAGAGTTAGAATTTGAATCTGGG - Intronic
922898489 1:229118759-229118781 CAGAGTTGGGGGTTTAAACTCGG + Intergenic
923180046 1:231508851-231508873 CAGGGTTAGAATTTAAAAGCCGG - Intergenic
923425373 1:233863475-233863497 CAGAGGTTGAAGTTTGATGTGGG - Intergenic
923559824 1:235030605-235030627 CAGAGCTGGAATTTTAGAGTAGG - Intergenic
923589620 1:235307767-235307789 AAGAGTTAATATTTTAAAGTAGG - Intronic
1063438313 10:6052331-6052353 CTGAGATACAAGTTTAAAGAAGG - Intronic
1064321170 10:14306140-14306162 ACAAGTTAGAAATTTAAAGTGGG + Intronic
1065148657 10:22799264-22799286 CATAGGTAGTAGTTAAAAGTAGG + Intergenic
1068990184 10:63142071-63142093 CAGAGTTTGAAGTTTAATTATGG + Intronic
1071928611 10:90440230-90440252 CAGAGTAAGAAGTTTGATTTTGG + Intergenic
1073157121 10:101355887-101355909 CATATTTAGAATTTTAATGTTGG - Intronic
1073227718 10:101937674-101937696 TAGAGTTTGAAGATTAAAGAAGG + Intronic
1074146632 10:110722429-110722451 CAGAGTCCGTAGTTTACAGTGGG + Intronic
1074417517 10:113280160-113280182 CAGAGTAAGGAGTTCAAAATTGG + Intergenic
1077388660 11:2288707-2288729 CAGAGTTAGAACCTTACAGAGGG - Intergenic
1078849954 11:15154754-15154776 CAGACTTAGAATGTTAAAGCTGG - Intronic
1080829563 11:35878721-35878743 CAGAGTCAGAACTTGAAACTTGG + Intergenic
1083119369 11:60496004-60496026 CAGAGTTAGGACTTGAAAATGGG - Intronic
1085426732 11:76411403-76411425 CTGAGCTAGAAGTTTAAATTGGG - Intronic
1086153197 11:83636146-83636168 CAGAGTTAGATGTTTAAGAAGGG - Intronic
1086314293 11:85574260-85574282 CAAGGTTAGAAATTTAAATTTGG - Intronic
1086342738 11:85863255-85863277 TAGAATTAGAATTTTAAACTTGG - Intronic
1087221674 11:95553017-95553039 TAGAGTCAGAAGATTCAAGTGGG + Intergenic
1087282007 11:96221502-96221524 CAGAGTAATAATTTTAAAGGTGG - Intronic
1087751430 11:102011495-102011517 CAGAGTTGGCATTTTAAATTTGG - Intergenic
1087752362 11:102020590-102020612 CAGAGTTGGACGTTTAAACTTGG - Intergenic
1088536534 11:110867748-110867770 CAGAGTTAGAAGTTCCTGGTTGG - Intergenic
1091289866 11:134433100-134433122 CAGAGTTAGGAGTTTATTCTTGG - Intergenic
1093050558 12:14499581-14499603 CAAAGTTAAAAGGTTAAAATGGG - Intronic
1093518365 12:20018170-20018192 AAGATTTAGATGTTAAAAGTTGG + Intergenic
1095563995 12:43599164-43599186 CAGATTTGGAAATGTAAAGTAGG - Intergenic
1096635644 12:52957339-52957361 CAGAGCTGGAAGCTTAAAGCAGG + Intergenic
1097752848 12:63377342-63377364 TAGAGTTAGAAGTTGGAAGTTGG - Intergenic
1098384137 12:69900733-69900755 CTGAGTTAGAAGTGAAAAGCTGG - Intronic
1100890570 12:99121125-99121147 CATAGTTAGAGGTTTTAATTTGG + Intronic
1100981769 12:100167650-100167672 AAGAGTGAGAAGTTTAGATTTGG + Intergenic
1103138823 12:118530904-118530926 CAGAGTTGGAAAGTTAAATTTGG - Intergenic
1104560473 12:129839557-129839579 AAGAGTTTGAAGTTTAAGGCCGG - Intronic
1105224101 13:18412013-18412035 CAAAGTGAGAGATTTAAAGTTGG + Intergenic
1108147444 13:47493896-47493918 TTGAGAAAGAAGTTTAAAGTTGG + Intergenic
1110827613 13:79990895-79990917 CGGGGTTAGGAGTTTGAAGTGGG - Intergenic
1111415270 13:87933039-87933061 CAGGGTTAGCATTGTAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112930838 13:104735206-104735228 CAGACTTAGAACTTCAAACTAGG + Intergenic
1113680568 13:112241292-112241314 CTGAGTTTGATGTTAAAAGTAGG - Intergenic
1114008249 14:18336833-18336855 CAAAGTGAGAGATTTAAAGTTGG + Intergenic
1114396935 14:22372387-22372409 CAGAGATAGAATTTTAAGGATGG - Intergenic
1116678101 14:47931535-47931557 CAGAGTAAGTAGTTTAAATTGGG - Intergenic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1118986808 14:70763096-70763118 CAGTGGTAGAAGTTTACAGTGGG - Intronic
1119027990 14:71168928-71168950 AAAAGTTAGAAATTTAAAGGAGG - Intergenic
1119496495 14:75084127-75084149 GAGAGGGAGAAGTGTAAAGTTGG - Exonic
1119501520 14:75132082-75132104 CACATTTAAAAGTTTAAAGATGG + Exonic
1119772242 14:77227520-77227542 CAGAGTTAGAGATTTCAACTTGG + Intronic
1120167573 14:81217988-81218010 TAGAATTAGAATGTTAAAGTAGG - Intronic
1120548634 14:85841894-85841916 CAGAGTCATAATTTTAAATTTGG + Intergenic
1121800438 14:96769823-96769845 CAGAGTTAGGACTTCAAGGTAGG + Intergenic
1122457496 14:101865593-101865615 CACAGTTAGCAGATTAAAGTTGG - Intronic
1124537329 15:30557718-30557740 AAGAGTTAGAAGTTTCAATCTGG - Intronic
1125254004 15:37741963-37741985 GAAAGTTAGACTTTTAAAGTAGG - Intergenic
1125501941 15:40245386-40245408 CAGAGTTAAAACTTTAAAACCGG + Intronic
1126339862 15:47627406-47627428 CAGGGTTAGAATTTTAACCTTGG - Intronic
1126394747 15:48202836-48202858 GAGAGTCAGAAGTTTGTAGTTGG - Exonic
1130635583 15:85616651-85616673 GAGAGTTACAAATTTAAAGGAGG - Intronic
1131372395 15:91893734-91893756 CAGAGTTAGAACTTTTAGGCCGG + Intronic
1134649388 16:15896605-15896627 CATAGTTAAAAGTTAAAATTAGG - Intergenic
1135143737 16:19943610-19943632 CAGCTTTAGAAGTTTGAACTGGG - Intergenic
1138873122 16:60917111-60917133 CAGAGTAAGATGTTAAAAGAAGG - Intergenic
1141106083 16:81234914-81234936 CAGAGTAAGTACTTTGAAGTCGG + Intergenic
1141393973 16:83688417-83688439 CAGATTTAAGAGTTTAAATTGGG + Intronic
1143338189 17:6189200-6189222 AAGACATAGAAGTCTAAAGTTGG - Intergenic
1143795938 17:9336732-9336754 CCCAGTTAGAAATTGAAAGTAGG - Intronic
1149882279 17:60305026-60305048 CAGAGTCAGAATTTTAACCTAGG + Intronic
1149954365 17:61031469-61031491 CAAAGTTAGAAATTTTAACTTGG - Intronic
1152968698 18:140836-140858 CAGAGTTCATAGTTTAAATTAGG - Intergenic
1153420747 18:4902148-4902170 CAGATTTAGATGCTTTAAGTAGG - Intergenic
1153652539 18:7253712-7253734 CAGAATTTGTAGTTTTAAGTAGG + Intergenic
1154529205 18:15327116-15327138 CAAAGTGAGAGATTTAAAGTTGG - Intergenic
1156287859 18:35716434-35716456 CAGAGGTCGAAGTTCAAATTTGG + Intergenic
1157671205 18:49530374-49530396 GGGAATTGGAAGTTTAAAGTAGG + Intergenic
1158236122 18:55316447-55316469 CAGTAATAGAAGTTTCAAGTAGG + Intronic
1161252731 19:3289855-3289877 CAGAGTTTGAAGTTTAGGGAGGG + Intronic
1165291892 19:34892343-34892365 CAGACTGAGAAGTTGAAACTGGG - Intergenic
1166161186 19:40954658-40954680 CAGAGTGAGAATTTAAAAGGTGG - Intergenic
1167884249 19:52487424-52487446 CAGATTGAGAATTTTAAAATTGG + Intronic
1167889700 19:52529505-52529527 CAGATTGAGAATTTTAAAATTGG + Intronic
1168564477 19:57411727-57411749 CAGAGGTAGACGTTTAAAGTTGG + Intronic
1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG + Intronic
925182958 2:1828922-1828944 CAGAGTTAGAACTTTAAGTTTGG + Intronic
925668417 2:6286782-6286804 CTGTGTTAAAAGTTTAAAGCAGG - Intergenic
925883871 2:8377287-8377309 GAGAATTAGAATTTTAAAATAGG - Intergenic
926575757 2:14579098-14579120 CAGCATTAGAAGTTCAAAGCTGG - Intergenic
928968713 2:37004123-37004145 GTGAGTAAGAAGCTTAAAGTGGG - Intronic
931480270 2:62632964-62632986 CTGAGTTAGAAGTTCAACATGGG + Intergenic
931625273 2:64251546-64251568 CAGAGTTGGAACTTCAGAGTTGG + Intergenic
932033774 2:68219214-68219236 CAGAATTTGAAGTAAAAAGTGGG - Intronic
932995902 2:76852182-76852204 CAGAATTAGAAGTTTGGAGTTGG - Intronic
933035930 2:77398089-77398111 AAGAATTAGGAGTTCAAAGTAGG - Intronic
935590728 2:104843913-104843935 CAGAGTTCGAAGGGGAAAGTGGG + Intergenic
936690631 2:114884325-114884347 AAGTGTTAGAAGTCTAAAATAGG + Intronic
937671248 2:124539472-124539494 CAGACTCAGAATTTTAAGGTGGG + Intronic
938528307 2:132158530-132158552 CAAAGTGAGAGATTTAAAGTTGG - Intronic
938725799 2:134107981-134108003 CAGAGTTAGAAGTAGTACGTGGG + Intergenic
939276957 2:140011327-140011349 CTGAGTTACAAGTACAAAGTAGG + Intergenic
940619918 2:156098902-156098924 CATAGATAGAAGGTCAAAGTTGG - Intergenic
942261100 2:174164317-174164339 CAAGGTTAGAAGGTTAGAGTTGG + Intronic
943459400 2:188152675-188152697 CAGAGTAAGAAGTATAAAGCAGG + Intergenic
943603285 2:189946313-189946335 CAAAGATAGAAGTTTAAAGCTGG + Intronic
944028760 2:195206126-195206148 AAGATTTAGAAGGTTAGAGTAGG - Intergenic
945768576 2:214011947-214011969 CAAAGTTAGAAATGTAAAATGGG - Intronic
946009152 2:216550856-216550878 CTGAGTTAGGATTTGAAAGTAGG + Intronic
1169488105 20:6050492-6050514 CAGTCTTAGAAATTTACAGTGGG - Intronic
1169753258 20:9017064-9017086 CAGAGTTATAAGTGTTAAGATGG + Intergenic
1169777370 20:9270638-9270660 CTGAGTTTGAAGTTGCAAGTAGG - Intronic
1175082021 20:56428709-56428731 AAGAGTTAGCAGATTAGAGTAGG + Intronic
1176768192 21:13041371-13041393 CAAAGTGAGAGATTTAAAGTTGG + Intergenic
1177563572 21:22788484-22788506 CAGAGTTATAGGTTGACAGTGGG - Intergenic
1178173133 21:30064637-30064659 CTGACTTAGAAATTTGAAGTAGG - Intergenic
1178573838 21:33766862-33766884 CAAAGTTAAAAGTGTAAAGTGGG + Intronic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1180432754 22:15267650-15267672 CAAAGTGAGAGATTTAAAGTTGG + Intergenic
1180515325 22:16135597-16135619 CAAAGTGAGAGGTTTAAAGTTGG + Intergenic
1182044787 22:27265802-27265824 CACAGATAGAAGTTGGAAGTCGG + Intergenic
1182386867 22:29950850-29950872 CTGAGTTAAAAGTATAAAGTGGG + Intronic
1182714477 22:32346054-32346076 TAGAGGTAGAAATTTAAAGCAGG + Intergenic
950324250 3:12090466-12090488 CAGAGCCAGAAATTTAAACTTGG - Intronic
951999966 3:28773639-28773661 TAGAGATGGAAATTTAAAGTAGG - Intergenic
953501979 3:43445355-43445377 CAGTGTTAGATGTTAAAAGTAGG + Intronic
954458694 3:50613610-50613632 CAGAGTTACAATTTTGAACTTGG + Intronic
954571666 3:51646084-51646106 CAGACTTAGATGTCTAAAGCTGG + Intronic
956740413 3:72271334-72271356 CAAAGTAAGAAGAGTAAAGTGGG - Intergenic
957927514 3:86833383-86833405 CAGAATCAGAAGTTTTGAGTGGG + Intergenic
958911499 3:99999359-99999381 CAGAGTCATAAGTATAGAGTTGG + Intronic
958986392 3:100784002-100784024 CAGAGGTTGAGGTCTAAAGTGGG - Intronic
960251195 3:115455963-115455985 CAGAATTAGAAGAACAAAGTTGG - Intergenic
960601252 3:119460740-119460762 CAAAGTTAGAATTTTTTAGTTGG + Intronic
960831119 3:121849558-121849580 GATAGTTAGAAGTTTGCAGTGGG - Intronic
961727067 3:128938274-128938296 CAAAGTTAAAAGTTTAAAAACGG + Intronic
961868276 3:129970211-129970233 CAAAATTAAAAGTTTAAATTAGG + Intergenic
963023801 3:140899070-140899092 CCATGTTAGAAGCTTAAAGTTGG - Intergenic
963855425 3:150248532-150248554 TAGATTTAGAAGTTCAACGTGGG + Intergenic
964190609 3:153996082-153996104 TAGAGTTAGAACTTTAACATAGG + Intergenic
964233200 3:154494786-154494808 GAGAGTTAAAAGTTTTAAATTGG + Intergenic
966355449 3:179073906-179073928 CAGAGTTTGTAGTTTAGAATTGG + Intergenic
968037707 3:195562057-195562079 CCGAGTTAGACTTTTGAAGTAGG + Intergenic
970062691 4:12052639-12052661 CAGAGTAAGAATTTTACGGTAGG - Intergenic
970135693 4:12920785-12920807 AAAAGTTAGAATTTTAAAGATGG - Intergenic
971947365 4:33298580-33298602 CAAAGCTAGAAGTCTAAAATCGG - Intergenic
974551248 4:63378271-63378293 CATAGTTACAATTTTAGAGTAGG - Intergenic
975170274 4:71224918-71224940 CAAAATTAGAACTTTAAAGTGGG + Intronic
975282823 4:72582328-72582350 CTGAGTTTGAAATTTAAAATGGG - Intergenic
975570218 4:75808833-75808855 TAGAGTTAGATTTTAAAAGTAGG + Intronic
977772326 4:100874398-100874420 CAGTGTTACATATTTAAAGTTGG - Intronic
978787165 4:112622711-112622733 AAGAGTTAGGATATTAAAGTTGG - Intronic
979221073 4:118225788-118225810 CATATTTAGCAGGTTAAAGTTGG + Intronic
979394413 4:120168968-120168990 TAGAGGGAGAAGTTTAAAGGAGG + Intergenic
979609666 4:122675770-122675792 CAGGGTTAGAATTTTAAAATTGG - Intergenic
980155163 4:129095676-129095698 CAAAGTTAGAAGTTTAAGCAAGG + Intronic
981342167 4:143634273-143634295 CTGAGAGAGAGGTTTAAAGTTGG + Intronic
981727925 4:147867563-147867585 CACAATTAGAAGTTGAGAGTGGG + Intronic
982358653 4:154495183-154495205 CAGAGTTTTAGCTTTAAAGTTGG + Intergenic
984561304 4:181273777-181273799 GAGAGTTAGAAGTCCCAAGTGGG + Intergenic
985618056 5:936514-936536 CAGAGGGAGAACTTTAAAGCGGG - Intergenic
985870684 5:2553245-2553267 TAAAGTAAGAAGTTTCAAGTGGG - Intergenic
986936311 5:12891939-12891961 TAGAGTTAGTAGTGTAAAATAGG + Intergenic
987506389 5:18778906-18778928 CAGGGTTAGAAGTATAGAATGGG - Intergenic
987643261 5:20638308-20638330 CTGAGTTAGAAGAATAAAGCTGG + Intergenic
987791137 5:22569748-22569770 TAGAGTTAGAAGTTTAGAAGTGG - Intronic
988362997 5:30260101-30260123 AATGGTTAGAAGTTTAGAGTGGG + Intergenic
988383034 5:30524265-30524287 CAAAGTAAGAAATGTAAAGTAGG - Intergenic
989961635 5:50422710-50422732 AAAAGTTTAAAGTTTAAAGTGGG + Intronic
991190489 5:63867610-63867632 CTGAGGTTGAAGTTTAAAGTAGG + Intergenic
992614969 5:78538939-78538961 CAGAGCTAGGAATTTGAAGTAGG - Intronic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
993239162 5:85357994-85358016 CAGAGTCATAATTTTAAATTTGG - Intergenic
993465551 5:88241787-88241809 GAGAGTTAGACGTTTGAAGGGGG - Intronic
993698664 5:91092702-91092724 CAGAGTAAGAAAAATAAAGTTGG + Intronic
993794228 5:92247665-92247687 AAGAGCTAGATGTTTTAAGTAGG - Intergenic
995826205 5:116302511-116302533 GAGAGTTAGAAGTGTCAAGCAGG - Intronic
996573612 5:124959547-124959569 CAGAGATAGGAGTTTTAAGGAGG + Intergenic
998491886 5:142554247-142554269 CAGATTTAGAATTTCAGAGTCGG + Intergenic
998729223 5:145054649-145054671 GATAGCTAGAAGTTTAAAATTGG - Intergenic
999847201 5:155496780-155496802 CAGAAATACAAGTTTAAAGAAGG - Intergenic
1003588707 6:7418254-7418276 AAGAGTTTGCAGTTTAAAATAGG + Intergenic
1004199834 6:13537530-13537552 CAGTGTTATAAAATTAAAGTTGG + Intergenic
1004363470 6:14991836-14991858 AAGAGTTAGACGTGTATAGTTGG + Intergenic
1007224830 6:40305853-40305875 AAGAGGTAGAAGTTGAAAGAGGG + Intergenic
1008426576 6:51365100-51365122 CACAGGTAGAAGCTTAGAGTTGG - Intergenic
1009491577 6:64299125-64299147 CTGAGTTAATAGCTTAAAGTAGG + Intronic
1010227986 6:73509460-73509482 TAGAGTTATAAGGTCAAAGTGGG - Intergenic
1010265098 6:73856916-73856938 CAACGTTACAAGGTTAAAGTTGG + Intergenic
1011978582 6:93340852-93340874 CAAAGTTAGCTGTGTAAAGTTGG + Intronic
1012247249 6:96939478-96939500 CATTGTTAAAAGTATAAAGTGGG + Intronic
1012617116 6:101290928-101290950 CAGAGATGGAAGTTGAAGGTAGG - Intergenic
1014377800 6:120698508-120698530 AGGAGTCAGAAGTTTAAAGAGGG - Intergenic
1014573600 6:123042517-123042539 CAGAGATAAGAGTTTAAATTGGG - Intronic
1014694167 6:124598020-124598042 CAAAGTTAGATGTTTTAAGAAGG - Intronic
1014853744 6:126373752-126373774 AAGAGTTAGAAAGTCAAAGTTGG + Intergenic
1015838193 6:137445131-137445153 CAGATGTAGAAGTTTCACGTGGG + Intergenic
1016394634 6:143610416-143610438 CAGAGCTAGTAGTTTAGAGCGGG + Intronic
1017996343 6:159534644-159534666 GAGAGTTAGCAGGTTACAGTAGG + Intergenic
1018305556 6:162450920-162450942 CAATGTAAGAAGTTTAAAATAGG + Intronic
1019502850 7:1373713-1373735 CACAGTTAGAATTTTAATCTGGG + Intergenic
1021612408 7:22471078-22471100 CTGACTTAGAAGTTTGAAGAAGG - Intronic
1022596722 7:31719900-31719922 CATACTTAGAAGTCTAATGTGGG + Intergenic
1022964595 7:35460784-35460806 CAGAGTTAGAATATGAAAGACGG - Intergenic
1026092766 7:67315171-67315193 CTGAGCTAGAAGTGTCAAGTTGG - Intergenic
1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG + Intergenic
1027795965 7:82694353-82694375 CCTAGTTAGAAATTTAAATTTGG - Intergenic
1028655724 7:93204425-93204447 CTCAGTTAAAACTTTAAAGTAGG + Intronic
1029884176 7:103849584-103849606 CAGAGTATGAAGTTTGAAGAAGG - Intronic
1030370659 7:108695645-108695667 CAGAATTAAAATTTTAAACTAGG + Intergenic
1032635885 7:133708085-133708107 CAGACTCAGAAGTTGGAAGTAGG + Intronic
1032954865 7:136959284-136959306 CAGAGTATGAATTTTAAAGGAGG + Intronic
1037142119 8:15532547-15532569 GAGAGTAAGAAGTTTAAAAAGGG + Intronic
1037449591 8:19003426-19003448 GAGAGTGAGAAGTGTGAAGTTGG - Intronic
1038510496 8:28129951-28129973 CGGGGTTAGTAGTTTAAAGCAGG + Intronic
1039140756 8:34385159-34385181 CAGAGTTAGAGGCTTAAAAAAGG + Intergenic
1039357809 8:36840706-36840728 GAAACTTAGAAGTTTACAGTTGG + Intronic
1041050042 8:53925472-53925494 CAAAGTTAGAAGTTAAAACTAGG + Intronic
1041300659 8:56407885-56407907 CTGATATAGAAGTTTAAGGTGGG - Intergenic
1044893545 8:96863310-96863332 CAGAGTTGGAGGTTTAGACTTGG + Intronic
1044942109 8:97353925-97353947 CAGAGTTAGAAGTGGAAAAATGG + Intergenic
1047850527 8:128852277-128852299 TGGAGTTAGAAGTGTAAAATGGG - Intergenic
1047913540 8:129557050-129557072 CAGAGTTAGAATTTGCCAGTGGG + Intergenic
1047970089 8:130077104-130077126 CAGAGGTAGAAGTGGAAATTCGG + Intronic
1047978130 8:130151872-130151894 CAGAATTGGAAGTTCAAACTCGG - Intronic
1048565204 8:135588797-135588819 CAGAGTTAGAAATTTAGATTTGG - Intronic
1049379926 8:142306988-142307010 CAGTGTTAGAAGTTGGAACTGGG - Intronic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050418544 9:5438735-5438757 CAGAGCTAGAAATTGAAGGTAGG - Intergenic
1051144453 9:14011409-14011431 CTGACTTAGAAGTTTGAATTAGG + Intergenic
1052164922 9:25313716-25313738 CAGATACAGAATTTTAAAGTTGG + Intergenic
1052261662 9:26523674-26523696 TAGATTTACAAGTTTAAATTAGG + Intergenic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1053168991 9:35864994-35865016 CAGAGTTTGAACTTTAAATTGGG - Intergenic
1053395185 9:37767173-37767195 TAGAGTTAGAAGTTTCAGGTAGG - Intronic
1053706921 9:40764862-40764884 CAAAGTGAGAGATTTAAAGTTGG - Intergenic
1054416835 9:64885628-64885650 CAAAGTGAGAGATTTAAAGTTGG - Intergenic
1057549627 9:96042694-96042716 CAGATTTAGAAGGTAAGAGTGGG - Intergenic
1058354645 9:104069530-104069552 CAGCCTCAGAAGTTCAAAGTAGG + Intergenic
1059060484 9:111030825-111030847 AAGAGTGAGAAGTTTGAAGCTGG - Intronic
1059382827 9:113941299-113941321 CAGAAAAAGAAGTTTTAAGTTGG - Intronic
1059755811 9:117292237-117292259 AAGAGTTAGAAACTTCAAGTTGG - Intronic
1060367224 9:123029545-123029567 TGGAGTTATAAGTTTATAGTTGG + Intronic
1061413886 9:130435383-130435405 AAGAGTTAGAAGATAAAAATAGG - Intergenic
1185986737 X:4843277-4843299 CAGAGATAGAACTTCAAAGGGGG + Intergenic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1190874493 X:54449934-54449956 CAGTGTTACAAGTGTAAAATGGG + Intronic
1191765064 X:64689363-64689385 CAGACTTAAAAGTGTAAATTTGG - Intergenic
1191934764 X:66414985-66415007 CACAATTAGAAGTTTAAAATAGG + Intergenic
1194431583 X:93813807-93813829 CAGAGTTAAACATTTGAAGTTGG + Intergenic
1194846510 X:98815942-98815964 CAGAATTAGAAATATTAAGTGGG + Intergenic
1196387402 X:115173497-115173519 TTGAGTTAATAGTTTAAAGTAGG - Intronic
1197041706 X:121944179-121944201 CAAAGTGAGAAGTTTATAGCTGG - Intergenic
1198231045 X:134689810-134689832 AAGATAGAGAAGTTTAAAGTTGG - Intronic
1198579467 X:138048080-138048102 CAGAGTTGGAACTGAAAAGTAGG + Intergenic
1202164162 Y:21969062-21969084 CAAATATAGAAGTGTAAAGTGGG + Intergenic
1202227194 Y:22617310-22617332 CAAATATAGAAGTGTAAAGTGGG - Intergenic
1202315928 Y:23578344-23578366 CAAATATAGAAGTGTAAAGTGGG + Intergenic
1202554837 Y:26091723-26091745 CAAATATAGAAGTGTAAAGTGGG - Intergenic