ID: 1168567660

View in Genome Browser
Species Human (GRCh38)
Location 19:57438592-57438614
Sequence TGCCACTGCAATGGACCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3084
Summary {0: 1, 1: 0, 2: 5, 3: 129, 4: 2949}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168567660_1168567667 22 Left 1168567660 19:57438592-57438614 CCACAGGGTCCATTGCAGTGGCA 0: 1
1: 0
2: 5
3: 129
4: 2949
Right 1168567667 19:57438637-57438659 AGGTAAGTCAAGGATTTCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 130
1168567660_1168567664 12 Left 1168567660 19:57438592-57438614 CCACAGGGTCCATTGCAGTGGCA 0: 1
1: 0
2: 5
3: 129
4: 2949
Right 1168567664 19:57438627-57438649 GACCCTGCACAGGTAAGTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1168567660_1168567663 2 Left 1168567660 19:57438592-57438614 CCACAGGGTCCATTGCAGTGGCA 0: 1
1: 0
2: 5
3: 129
4: 2949
Right 1168567663 19:57438617-57438639 AATGCATAAGGACCCTGCACAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1168567660_1168567662 -10 Left 1168567660 19:57438592-57438614 CCACAGGGTCCATTGCAGTGGCA 0: 1
1: 0
2: 5
3: 129
4: 2949
Right 1168567662 19:57438605-57438627 TGCAGTGGCAGCAATGCATAAGG 0: 1
1: 0
2: 1
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168567660 Original CRISPR TGCCACTGCAATGGACCCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr