ID: 1168574642

View in Genome Browser
Species Human (GRCh38)
Location 19:57499913-57499935
Sequence GAACTCAGCTTGCCGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168574635_1168574642 18 Left 1168574635 19:57499872-57499894 CCGGCGTCTCCCCTCGGCGGTTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1168574637_1168574642 8 Left 1168574637 19:57499882-57499904 CCCTCGGCGGTTGCTTTCGCTGC 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1168574636_1168574642 9 Left 1168574636 19:57499881-57499903 CCCCTCGGCGGTTGCTTTCGCTG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1168574638_1168574642 7 Left 1168574638 19:57499883-57499905 CCTCGGCGGTTGCTTTCGCTGCC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168574642 Original CRISPR GAACTCAGCTTGCCGGAAGC TGG Intronic
901394587 1:8971767-8971789 GACCCCAGCGTGCTGGAAGCAGG + Intronic
906129844 1:43449555-43449577 AGACTCAGCTTGCCCCAAGCTGG - Intronic
907337781 1:53711552-53711574 GAACTTAGCTTGGCGGACCCCGG - Intronic
910138559 1:83999992-84000014 GAACCCAGCGTGACAGAAGCAGG - Intergenic
910723379 1:90312260-90312282 GAACTCAGCTTCTTGGAAACTGG + Intergenic
912561563 1:110555259-110555281 GAACTCAGCGCTGCGGAAGCCGG + Intergenic
912614550 1:111085297-111085319 CAACTCAGCTTGGAGGCAGCAGG + Intergenic
913551085 1:119917440-119917462 GTACTCAGCTTGCAGTAGGCTGG - Intronic
915507651 1:156367700-156367722 GAACTCAGGTTGGGGGAGGCTGG - Intronic
916906275 1:169288166-169288188 GAACAAAGGTTGCCGGAAGGAGG - Intronic
1063069516 10:2647007-2647029 GAATTCACCTTGCAGGAGGCTGG + Intergenic
1067910989 10:50346812-50346834 CAACTCAGCCTCCCAGAAGCTGG + Intronic
1071465867 10:85939163-85939185 GAACTCAGGTTGGAGGAATCAGG - Intronic
1075730039 10:124630597-124630619 GAAATCAGGTTGCCAGGAGCGGG + Intronic
1076254799 10:129013635-129013657 GAAGTCAGCTGGCTGGATGCAGG + Intergenic
1076538126 10:131195930-131195952 GAACACAGGATGCGGGAAGCTGG + Intronic
1082679760 11:56153034-56153056 GAACTAAGCTTGCCCTAAGTTGG - Intergenic
1084143668 11:67251337-67251359 GGACTCTGCTTGCTGGAAGAGGG - Intronic
1091995090 12:4987164-4987186 GAACGCTGCCTGCCGAAAGCTGG + Intergenic
1095280190 12:40342211-40342233 GAACTCAGCTGGCTGCTAGCTGG - Intronic
1096607968 12:52780373-52780395 GAACTCAGATTGCTGGCAGTAGG - Intergenic
1104742260 12:131186915-131186937 GAATAGTGCTTGCCGGAAGCTGG + Intergenic
1104882120 12:132079378-132079400 GAGCGCAGCTTGCCGGAGGGAGG + Exonic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1115696376 14:35903619-35903641 TCACTCACTTTGCCGGAAGCTGG + Intronic
1117289729 14:54320820-54320842 GAACTCAGCTGGCAGCCAGCGGG - Intergenic
1119392336 14:74299459-74299481 GAACTTAGCCTCCAGGAAGCAGG - Intronic
1121426728 14:93857576-93857598 GGGCTCAGCTTTCCAGAAGCAGG + Intergenic
1128551153 15:68598845-68598867 TGACTCTGCTTGCGGGAAGCTGG + Intronic
1130664133 15:85854943-85854965 GAGCTCAGCCTGCAGGGAGCTGG + Intergenic
1132787800 16:1667659-1667681 GAACTCAGCTTTCTGGGAGGAGG + Intronic
1138334986 16:56246002-56246024 GATCTCAGCTGGGAGGAAGCAGG - Intronic
1138497422 16:57416723-57416745 GCGCCCAGCCTGCCGGAAGCCGG + Intergenic
1139564262 16:67763475-67763497 GAACTCAGGTTTCTGGAAGTGGG + Intronic
1140838094 16:78814149-78814171 TGACTCCGCTTGCCGGCAGCGGG - Intronic
1144622420 17:16825974-16825996 GCACTCAGCTTCCAGAAAGCTGG + Intergenic
1144884003 17:18446736-18446758 GCACTCAGCTTCCAGAAAGCTGG - Intergenic
1145148227 17:20497641-20497663 GCACTCAGCTTCCAGAAAGCTGG + Intergenic
1147576771 17:41605896-41605918 GCACTCAGCTTCCAGAAAGCTGG + Intergenic
1148022961 17:44565776-44565798 GAACTCAGTTTGCTGACAGCAGG - Intergenic
1150231083 17:63550836-63550858 GAACCCAGCTGGCGGGGAGCGGG + Intronic
1150335250 17:64326253-64326275 GAACTCAGCAAGGCAGAAGCTGG + Intronic
1154082470 18:11271924-11271946 GAACTCAGGGTGCCTGAACCAGG - Intergenic
1154256138 18:12782261-12782283 GTTCTCAGCTTGCCGGAGGTGGG + Intergenic
1167034809 19:46988797-46988819 GGGCTCAGCTGGCCGGCAGCAGG + Intronic
1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG + Intronic
925303316 2:2832347-2832369 GAACTCAGATGGCCAGAACCTGG + Intergenic
928214416 2:29349542-29349564 CAACTCCGCTTCCAGGAAGCAGG + Intronic
931545194 2:63375837-63375859 GAACTCAGATTGCCTGAATTTGG - Intronic
934708655 2:96501729-96501751 CCACTCAGCCTGCAGGAAGCTGG + Intronic
938145678 2:128833271-128833293 ACACTCAGCTTCCCAGAAGCTGG + Intergenic
942901951 2:181131063-181131085 GAACTCACTTTGCCTGCAGCTGG - Intergenic
947466034 2:230347440-230347462 GAGCCCAGCTTGCAGCAAGCTGG - Intronic
947616278 2:231559101-231559123 GGACTCAGCTTTCAGGAAGGGGG - Intergenic
948116683 2:235498652-235498674 TAATTCAGCTTGCCAGCAGCAGG + Intronic
1174414324 20:50357108-50357130 CCACGCAGCTTGCCGGAAGGTGG - Intergenic
1175333642 20:58180962-58180984 GAACACAGCTGGCCGGCACCTGG + Intergenic
1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG + Intergenic
949565173 3:5237845-5237867 GAACTCAACTTGGCCGCAGCAGG - Intergenic
954434956 3:50491020-50491042 GCACTCAGCATGGAGGAAGCTGG - Intronic
955489429 3:59467683-59467705 GAACCCAGCTGGCTGGCAGCTGG - Intergenic
967503149 3:190223051-190223073 GAATTCAGGTTGCTGTAAGCTGG + Intergenic
967767747 3:193300314-193300336 AAAATCAGCTTCCCAGAAGCAGG + Intronic
968913815 4:3488516-3488538 GAACCCAGCCTGGCGGAGGCTGG - Intronic
975523829 4:75328194-75328216 GAACGCAGCTTGCTGGAGGAGGG - Intergenic
981956410 4:150479163-150479185 CACCTCAGCTTCCCGGTAGCTGG - Intronic
984880488 4:184406128-184406150 CAACTCAGCTTCCAGGAAGAAGG + Intronic
985288132 4:188357952-188357974 TAACTCACCTTGCCTGAAACAGG - Intergenic
985574271 5:666283-666305 GAAGAAAGCTTGGCGGAAGCAGG + Intronic
993835419 5:92813820-92813842 GAACAAAGCTTGCTGGAAGAGGG - Intergenic
994399041 5:99256498-99256520 GATCTCAGCTTGCCCTAAGTTGG + Intergenic
994927023 5:106128893-106128915 CACCTCAGCTTCCCGGTAGCTGG - Intergenic
998187997 5:139997795-139997817 GACCTCAGCTTGTAGGCAGCAGG - Intronic
998814283 5:145996784-145996806 GAACTCAGATTACCTGATGCTGG - Intronic
1002909689 6:1480295-1480317 AAACTCAGCCTGCTGAAAGCTGG + Intergenic
1002915334 6:1524154-1524176 GCACGCGGCTTGCCGGGAGCGGG - Intergenic
1004406479 6:15338043-15338065 GAACTCAGTTTGCCGACAGCAGG + Intronic
1008932484 6:56954987-56955009 GACCTCAGCATCCCAGAAGCCGG + Intergenic
1014255539 6:119157295-119157317 GAGCTCAGCTTGCAGGAGCCTGG + Intergenic
1019198759 6:170297020-170297042 GGGCTCAGCTTGCCGGGAGCGGG + Intronic
1022308392 7:29172233-29172255 GAACTCAGTGGGCCGGATGCTGG - Intronic
1023472336 7:40537268-40537290 GAACACAGCTTTCCTGAACCTGG - Intronic
1024264758 7:47598112-47598134 GAACTCAGTTTACCGACAGCAGG + Intergenic
1033033131 7:137846472-137846494 GAACTTAACTTTCCGGAAGCAGG - Exonic
1038228787 8:25681637-25681659 GAACTCAGGATGCCTGAAACTGG + Intergenic
1046051830 8:109032744-109032766 GGAATCAGCTTGCTGAAAGCTGG + Intergenic
1049115056 8:140678973-140678995 GCACTCAGCTGGCCGTGAGCTGG - Intronic
1051189632 9:14497972-14497994 GATCTAAACTTGCCTGAAGCTGG + Intergenic
1055661143 9:78505295-78505317 GAACTCAGCTATCTGGAACCTGG + Intergenic
1058696140 9:107560570-107560592 GAACTCAGCTCGCTGCAACCTGG + Intergenic
1061598744 9:131650754-131650776 AAACTCATATTGCTGGAAGCAGG + Intronic
1062575400 9:137204872-137204894 GCACTCAGCTCGGCGCAAGCCGG + Exonic
1190758610 X:53422172-53422194 GGACTGAGCTGGCGGGAAGCTGG + Intronic
1194699675 X:97098370-97098392 GAATTGAGGTTACCGGAAGCTGG - Intronic