ID: 1168575547

View in Genome Browser
Species Human (GRCh38)
Location 19:57505642-57505664
Sequence ACTGAATGTGTGGTGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168575536_1168575547 23 Left 1168575536 19:57505596-57505618 CCATGTTTCACCCCATCCTCAGC 0: 1
1: 0
2: 1
3: 22
4: 435
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data
1168575540_1168575547 7 Left 1168575540 19:57505612-57505634 CCTCAGCAGCACCTTTCAGCAGT No data
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data
1168575537_1168575547 13 Left 1168575537 19:57505606-57505628 CCCCATCCTCAGCAGCACCTTTC No data
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data
1168575542_1168575547 -4 Left 1168575542 19:57505623-57505645 CCTTTCAGCAGTGGCTTTCACTG No data
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data
1168575539_1168575547 11 Left 1168575539 19:57505608-57505630 CCATCCTCAGCAGCACCTTTCAG No data
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data
1168575538_1168575547 12 Left 1168575538 19:57505607-57505629 CCCATCCTCAGCAGCACCTTTCA No data
Right 1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168575547 Original CRISPR ACTGAATGTGTGGTGAGGTG GGG Intronic