ID: 1168582466

View in Genome Browser
Species Human (GRCh38)
Location 19:57566948-57566970
Sequence TGCTGTTAACAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582463_1168582466 0 Left 1168582463 19:57566925-57566947 CCCGACTGTTAAAGGTACAGCTT No data
Right 1168582466 19:57566948-57566970 TGCTGTTAACAGATGGAGCATGG No data
1168582464_1168582466 -1 Left 1168582464 19:57566926-57566948 CCGACTGTTAAAGGTACAGCTTT No data
Right 1168582466 19:57566948-57566970 TGCTGTTAACAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582466 Original CRISPR TGCTGTTAACAGATGGAGCA TGG Intergenic
No off target data available for this crispr