ID: 1168582889

View in Genome Browser
Species Human (GRCh38)
Location 19:57570103-57570125
Sequence AGTGGATTATTCTCGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582889_1168582899 25 Left 1168582889 19:57570103-57570125 CCCTTCTTCGAGAATAATCCACT No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582889_1168582894 5 Left 1168582889 19:57570103-57570125 CCCTTCTTCGAGAATAATCCACT No data
Right 1168582894 19:57570131-57570153 CAGTCCTGTTAACCAATCTCTGG No data
1168582889_1168582896 7 Left 1168582889 19:57570103-57570125 CCCTTCTTCGAGAATAATCCACT No data
Right 1168582896 19:57570133-57570155 GTCCTGTTAACCAATCTCTGGGG No data
1168582889_1168582895 6 Left 1168582889 19:57570103-57570125 CCCTTCTTCGAGAATAATCCACT No data
Right 1168582895 19:57570132-57570154 AGTCCTGTTAACCAATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582889 Original CRISPR AGTGGATTATTCTCGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr