ID: 1168582890

View in Genome Browser
Species Human (GRCh38)
Location 19:57570104-57570126
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582890_1168582894 4 Left 1168582890 19:57570104-57570126 CCTTCTTCGAGAATAATCCACTA No data
Right 1168582894 19:57570131-57570153 CAGTCCTGTTAACCAATCTCTGG No data
1168582890_1168582896 6 Left 1168582890 19:57570104-57570126 CCTTCTTCGAGAATAATCCACTA No data
Right 1168582896 19:57570133-57570155 GTCCTGTTAACCAATCTCTGGGG No data
1168582890_1168582895 5 Left 1168582890 19:57570104-57570126 CCTTCTTCGAGAATAATCCACTA No data
Right 1168582895 19:57570132-57570154 AGTCCTGTTAACCAATCTCTGGG No data
1168582890_1168582899 24 Left 1168582890 19:57570104-57570126 CCTTCTTCGAGAATAATCCACTA No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582890 Original CRISPR TAGTGGATTATTCTCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr