ID: 1168582891

View in Genome Browser
Species Human (GRCh38)
Location 19:57570121-57570143
Sequence GTTAACAGGACTGTGGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582891_1168582899 7 Left 1168582891 19:57570121-57570143 CCACTACCCACAGTCCTGTTAAC No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582891 Original CRISPR GTTAACAGGACTGTGGGTAG TGG (reversed) Intergenic
No off target data available for this crispr