ID: 1168582892

View in Genome Browser
Species Human (GRCh38)
Location 19:57570127-57570149
Sequence AGATTGGTTAACAGGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582892_1168582899 1 Left 1168582892 19:57570127-57570149 CCCACAGTCCTGTTAACCAATCT No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582892 Original CRISPR AGATTGGTTAACAGGACTGT GGG (reversed) Intergenic
No off target data available for this crispr