ID: 1168582893

View in Genome Browser
Species Human (GRCh38)
Location 19:57570128-57570150
Sequence GAGATTGGTTAACAGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582893_1168582904 30 Left 1168582893 19:57570128-57570150 CCACAGTCCTGTTAACCAATCTC No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582893_1168582899 0 Left 1168582893 19:57570128-57570150 CCACAGTCCTGTTAACCAATCTC No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582893 Original CRISPR GAGATTGGTTAACAGGACTG TGG (reversed) Intergenic
No off target data available for this crispr