ID: 1168582899

View in Genome Browser
Species Human (GRCh38)
Location 19:57570151-57570173
Sequence TGGGGATACCTGACCCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582890_1168582899 24 Left 1168582890 19:57570104-57570126 CCTTCTTCGAGAATAATCCACTA No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582897_1168582899 -7 Left 1168582897 19:57570135-57570157 CCTGTTAACCAATCTCTGGGGAT No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582891_1168582899 7 Left 1168582891 19:57570121-57570143 CCACTACCCACAGTCCTGTTAAC No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582888_1168582899 26 Left 1168582888 19:57570102-57570124 CCCCTTCTTCGAGAATAATCCAC No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582893_1168582899 0 Left 1168582893 19:57570128-57570150 CCACAGTCCTGTTAACCAATCTC No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582892_1168582899 1 Left 1168582892 19:57570127-57570149 CCCACAGTCCTGTTAACCAATCT No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data
1168582889_1168582899 25 Left 1168582889 19:57570103-57570125 CCCTTCTTCGAGAATAATCCACT No data
Right 1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582899 Original CRISPR TGGGGATACCTGACCCAACC AGG Intergenic
No off target data available for this crispr