ID: 1168582900

View in Genome Browser
Species Human (GRCh38)
Location 19:57570159-57570181
Sequence TGATCTAGCCTGGTTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582900_1168582907 20 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582900_1168582904 -1 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582900_1168582905 6 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582905 19:57570188-57570210 CTTGCCTGAATTCTGGAATAAGG No data
1168582900_1168582908 21 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582900 Original CRISPR TGATCTAGCCTGGTTGGGTC AGG (reversed) Intergenic