ID: 1168582901

View in Genome Browser
Species Human (GRCh38)
Location 19:57570164-57570186
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582901_1168582908 16 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data
1168582901_1168582905 1 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582905 19:57570188-57570210 CTTGCCTGAATTCTGGAATAAGG No data
1168582901_1168582904 -6 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582901_1168582907 15 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582901_1168582910 29 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582901_1168582911 30 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582901 Original CRISPR AAACTTGATCTAGCCTGGTT GGG (reversed) Intergenic