ID: 1168582903

View in Genome Browser
Species Human (GRCh38)
Location 19:57570169-57570191
Sequence CAAGAAAACTTGATCTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582903_1168582905 -4 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582905 19:57570188-57570210 CTTGCCTGAATTCTGGAATAAGG No data
1168582903_1168582907 10 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582903_1168582910 24 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582903_1168582911 25 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data
1168582903_1168582908 11 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582903 Original CRISPR CAAGAAAACTTGATCTAGCC TGG (reversed) Intergenic