ID: 1168582904

View in Genome Browser
Species Human (GRCh38)
Location 19:57570181-57570203
Sequence AAGTTTTCTTGCCTGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582902_1168582904 -7 Left 1168582902 19:57570165-57570187 CCAACCAGGCTAGATCAAGTTTT No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582893_1168582904 30 Left 1168582893 19:57570128-57570150 CCACAGTCCTGTTAACCAATCTC No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582900_1168582904 -1 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582897_1168582904 23 Left 1168582897 19:57570135-57570157 CCTGTTAACCAATCTCTGGGGAT No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582898_1168582904 15 Left 1168582898 19:57570143-57570165 CCAATCTCTGGGGATACCTGACC No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data
1168582901_1168582904 -6 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582904 19:57570181-57570203 AAGTTTTCTTGCCTGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582904 Original CRISPR AAGTTTTCTTGCCTGAATTC TGG Intergenic
No off target data available for this crispr