ID: 1168582906

View in Genome Browser
Species Human (GRCh38)
Location 19:57570192-57570214
Sequence AGGTCCTTATTCCAGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582906_1168582915 30 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582915 19:57570245-57570267 GGGTGAGGATTTGTGTTTAAAGG No data
1168582906_1168582914 15 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582914 19:57570230-57570252 GTGTGCTGGGCACTAGGGTGAGG No data
1168582906_1168582912 9 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582912 19:57570224-57570246 GGCAGAGTGTGCTGGGCACTAGG No data
1168582906_1168582910 1 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582906_1168582913 10 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582913 19:57570225-57570247 GCAGAGTGTGCTGGGCACTAGGG No data
1168582906_1168582911 2 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582906 Original CRISPR AGGTCCTTATTCCAGAATTC AGG (reversed) Intergenic