ID: 1168582907

View in Genome Browser
Species Human (GRCh38)
Location 19:57570202-57570224
Sequence GGAATAAGGACCTCAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582903_1168582907 10 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582900_1168582907 20 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582901_1168582907 15 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data
1168582902_1168582907 14 Left 1168582902 19:57570165-57570187 CCAACCAGGCTAGATCAAGTTTT No data
Right 1168582907 19:57570202-57570224 GGAATAAGGACCTCAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582907 Original CRISPR GGAATAAGGACCTCAGACAG AGG Intergenic
No off target data available for this crispr