ID: 1168582908

View in Genome Browser
Species Human (GRCh38)
Location 19:57570203-57570225
Sequence GAATAAGGACCTCAGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582900_1168582908 21 Left 1168582900 19:57570159-57570181 CCTGACCCAACCAGGCTAGATCA No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data
1168582903_1168582908 11 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data
1168582901_1168582908 16 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data
1168582902_1168582908 15 Left 1168582902 19:57570165-57570187 CCAACCAGGCTAGATCAAGTTTT No data
Right 1168582908 19:57570203-57570225 GAATAAGGACCTCAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582908 Original CRISPR GAATAAGGACCTCAGACAGA GGG Intergenic