ID: 1168582910

View in Genome Browser
Species Human (GRCh38)
Location 19:57570216-57570238
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582902_1168582910 28 Left 1168582902 19:57570165-57570187 CCAACCAGGCTAGATCAAGTTTT No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582903_1168582910 24 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582906_1168582910 1 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data
1168582901_1168582910 29 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582910 19:57570216-57570238 AGACAGAGGGCAGAGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582910 Original CRISPR AGACAGAGGGCAGAGTGTGC TGG Intergenic
No off target data available for this crispr