ID: 1168582911

View in Genome Browser
Species Human (GRCh38)
Location 19:57570217-57570239
Sequence GACAGAGGGCAGAGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168582901_1168582911 30 Left 1168582901 19:57570164-57570186 CCCAACCAGGCTAGATCAAGTTT No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data
1168582906_1168582911 2 Left 1168582906 19:57570192-57570214 CCTGAATTCTGGAATAAGGACCT No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data
1168582902_1168582911 29 Left 1168582902 19:57570165-57570187 CCAACCAGGCTAGATCAAGTTTT No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data
1168582903_1168582911 25 Left 1168582903 19:57570169-57570191 CCAGGCTAGATCAAGTTTTCTTG No data
Right 1168582911 19:57570217-57570239 GACAGAGGGCAGAGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168582911 Original CRISPR GACAGAGGGCAGAGTGTGCT GGG Intergenic
No off target data available for this crispr