ID: 1168584908

View in Genome Browser
Species Human (GRCh38)
Location 19:57584240-57584262
Sequence GTCCTCCCGCTGAACAGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168584908 Original CRISPR GTCCTCCCGCTGAACAGTGG GGG Exonic
900310404 1:2030666-2030688 GTCCATCCGGTGAACAGTGAAGG + Exonic
904616969 1:31755177-31755199 GTGTGCCCGCTGAACAGTGCTGG - Intronic
910337820 1:86154890-86154912 ATCTTCCCGCTGATCAGGGGCGG - Intronic
921339516 1:214120764-214120786 GGCCTCCCACTGCACACTGGTGG + Intergenic
1066182086 10:32972718-32972740 GTTCTTCCGCTTCACAGTGGAGG + Intronic
1072780787 10:98250117-98250139 GTCCTCCAGCTAGAAAGTGGTGG + Intronic
1075291794 10:121237084-121237106 GTCCTCCCACTGCTCTGTGGTGG - Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1079237558 11:18700924-18700946 GTCCTCCAGGTGAAGAGTGAAGG + Exonic
1080353129 11:31408309-31408331 GTCCTCCCTCTGAAGATTTGAGG + Intronic
1084412785 11:69013875-69013897 ATCCTCCCGCTGAGCAGCGCAGG - Intergenic
1089292026 11:117443286-117443308 GTCATTCCTCTGAAAAGTGGGGG + Intronic
1092231401 12:6777653-6777675 GTCATTCAGCTGATCAGTGGCGG - Intronic
1102051312 12:109864107-109864129 GAGCTCCCGCTCAACAGTAGGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103626762 12:122226008-122226030 GTCCGCGCGCTGCACAATGGCGG - Exonic
1103716631 12:122949036-122949058 GACATCCCGCTGTACAGCGGAGG + Intronic
1105255313 13:18740537-18740559 GTCACCCAGCTGAACAGTGGTGG - Intergenic
1109534143 13:63693987-63694009 ATCCTGCCGCTGCACTGTGGGGG - Intergenic
1114658727 14:24331477-24331499 GTCCTCCCGCTGCACACAGCAGG + Intronic
1119085506 14:71735337-71735359 GTCCTCCAGCTGATCACTGTTGG - Exonic
1124803958 15:32862215-32862237 GTCTTCCGGTTGAACAGTGAAGG - Intronic
1128735228 15:70049852-70049874 CTCCTCCCCCTGAACAATGCTGG - Exonic
1133015689 16:2938430-2938452 GTCCTCCTGCTGGGCCGTGGTGG - Exonic
1133556983 16:6915109-6915131 GTCCTCCAGCTAATCAGTGGCGG + Intronic
1137583667 16:49650885-49650907 GTCCTCCCACTGGACAGTCTGGG + Intronic
1140900469 16:79362376-79362398 GATCTCCCTCTGAAAAGTGGGGG - Intergenic
1141104263 16:81220299-81220321 TTCCTCTGGCTTAACAGTGGTGG + Intergenic
1142572557 17:884523-884545 GTCCTTCCCCTGGACAGTGCCGG - Intronic
1147390973 17:40108973-40108995 GTCCTCATGGTAAACAGTGGGGG + Intergenic
1149567802 17:57652199-57652221 GACCTCCCCCTGCACACTGGGGG - Intronic
1150971121 17:70029489-70029511 GTGCTCCAGCAGAGCAGTGGAGG + Intergenic
1152743870 17:82030482-82030504 GTCCTCCCGCCGCCCACTGGTGG + Intronic
1154369601 18:13747666-13747688 GTCCTCCCACTCAACATTGTGGG - Intronic
1154435705 18:14340065-14340087 GTCACCCAGCTGAACAGTGGTGG + Intergenic
1164990568 19:32679560-32679582 GTCCTCCTGAGGAATAGTGGGGG - Intergenic
1168584908 19:57584240-57584262 GTCCTCCCGCTGAACAGTGGGGG + Exonic
925623510 2:5818468-5818490 GTTCTCCCGCTGCCCAGTGATGG - Intergenic
925967356 2:9078516-9078538 GTGCTTCAGCTGATCAGTGGGGG + Intergenic
926938176 2:18107077-18107099 GTTCTTCCTCTGAACAATGGAGG - Intronic
929221015 2:39465223-39465245 CTCCTTCTGCTGAACTGTGGAGG + Intergenic
938278265 2:130047289-130047311 GTCACACAGCTGAACAGTGGTGG - Intergenic
938329236 2:130438094-130438116 GTCACACAGCTGAACAGTGGTGG - Intergenic
938360710 2:130683399-130683421 GTCACACAGCTGAACAGTGGTGG + Intergenic
938437112 2:131290097-131290119 GTCACACAGCTGAACAGTGGTGG + Intronic
941050761 2:160730980-160731002 TTCCTCCTGCTGATCAGTGGGGG + Intergenic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
1170998347 20:21388196-21388218 GTTCTCCTGCTGAACCGTGTGGG - Intronic
1171880132 20:30612511-30612533 GTCACACAGCTGAACAGTGGTGG - Intergenic
1173555314 20:43961597-43961619 GGCCTCCAGCTGCACTGTGGCGG + Intronic
1176841328 21:13845567-13845589 GTCACCCAGCTGAACAGTGGTGG - Intergenic
1179128560 21:38614029-38614051 CTCCACTCGTTGAACAGTGGGGG + Intronic
1179948174 21:44694473-44694495 GTCCTAGAGGTGAACAGTGGTGG + Intronic
1180233789 21:46444101-46444123 GTCCTCCCCCAGAACAGGGCGGG - Intronic
1182789078 22:32933770-32933792 CTCATTCAGCTGAACAGTGGGGG - Intronic
1182956658 22:34433180-34433202 GTCATCCCACTTAAAAGTGGTGG + Intergenic
1185176169 22:49328245-49328267 CTCCTGCAGCTGAACACTGGAGG - Intergenic
953907426 3:46875306-46875328 GACCTCCTGCTGAACAGATGAGG + Intronic
954795999 3:53161604-53161626 GTCCCTCCGCTAGACAGTGGGGG + Intronic
966820456 3:183920307-183920329 GCCCTGCCACTGAACTGTGGAGG + Exonic
968726063 4:2248320-2248342 ATCCACCCGGTGACCAGTGGTGG - Exonic
969258587 4:6019847-6019869 TTCCTCCCACTGAACACTAGGGG - Intergenic
982730143 4:158947024-158947046 CTCCTTCAGCTGAGCAGTGGGGG - Intronic
984443371 4:179801942-179801964 GTCCTCGGGCAGAGCAGTGGTGG - Intergenic
986245787 5:6005748-6005770 GGCGCCCCGCTGAACAGTAGAGG + Intergenic
997468170 5:134102026-134102048 CTGCTGCCGCTGAATAGTGGAGG - Intergenic
1007815597 6:44522946-44522968 GCCCTCCCACTGGACACTGGGGG + Intergenic
1019432505 7:1005776-1005798 GTCCTCCCGCAGGTGAGTGGGGG + Intronic
1023607435 7:41943171-41943193 GTGCTCCCGCTGAACAGGGACGG + Intergenic
1032104488 7:129015239-129015261 TTTCTCCCCCTTAACAGTGGTGG - Intronic
1049132886 8:140864668-140864690 GTTCTTCCCCTGAGCAGTGGTGG - Intronic
1051048148 9:12900021-12900043 ATCCTCCTGGTGAACACTGGAGG - Intergenic
1051239124 9:15033298-15033320 GTCCTTCCTCTGAACAGGGTGGG + Intergenic
1059816970 9:117927557-117927579 CTCCCCAGGCTGAACAGTGGAGG + Intergenic
1060518327 9:124279629-124279651 GTCCTCCCACTGCACAGGTGGGG - Intronic
1062322052 9:135994789-135994811 GTCCTCACACAGGACAGTGGCGG + Intergenic
1185468644 X:369862-369884 CGCCTCCCGCTGCAGAGTGGGGG - Intronic
1191136131 X:57067322-57067344 GTCCTTCAGCTGTATAGTGGAGG - Intergenic
1197246822 X:124174606-124174628 GCCCTCCTGCTGAACAGTGGCGG - Intronic
1198767346 X:140092463-140092485 GCCCTCCACCTGGACAGTGGGGG + Intergenic