ID: 1168586786

View in Genome Browser
Species Human (GRCh38)
Location 19:57600241-57600263
Sequence CTGGTGCTGGATCTCGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168586781_1168586786 2 Left 1168586781 19:57600216-57600238 CCGCACTGTCCGGCACAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1168586780_1168586786 7 Left 1168586780 19:57600211-57600233 CCGGACCGCACTGTCCGGCACAG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1168586779_1168586786 8 Left 1168586779 19:57600210-57600232 CCCGGACCGCACTGTCCGGCACA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 84
1168586784_1168586786 -7 Left 1168586784 19:57600225-57600247 CCGGCACAGTGAGGCGCTGGTGC 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168586786 Original CRISPR CTGGTGCTGGATCTCGTTTC TGG Intronic
902440386 1:16425581-16425603 CTGGCCCTTGATCTCCTTTCCGG + Intronic
902630088 1:17699605-17699627 CTGGTGCTGGAGCTGGCATCTGG + Intergenic
903326081 1:22569323-22569345 CTGGGGCTGGCTCACGTATCCGG + Exonic
903769861 1:25757088-25757110 TTGGGGCTGGATGTGGTTTCTGG - Intronic
905412693 1:37782656-37782678 TTGGTGCTGGAGCTGGGTTCGGG - Intergenic
910150185 1:84133564-84133586 CTGGTGCTGGAGCTAGTTGGCGG + Intronic
911063851 1:93770273-93770295 CTGATGCTGTACCTCCTTTCTGG - Intronic
916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG + Intergenic
920380194 1:205530643-205530665 CTGGAGCTGGATCTCCTTCAGGG - Exonic
1062963538 10:1591219-1591241 CTGGTGCTGCGTCTGGATTCAGG - Intronic
1064422839 10:15205132-15205154 CTGGTGCGGGATCTCGTCTTTGG + Intergenic
1069062574 10:63909577-63909599 CTGGTCCTAGATTTCCTTTCAGG - Intergenic
1071549619 10:86556641-86556663 CTAGTGCTGGATCTCATCTCAGG + Intergenic
1073060254 10:100729652-100729674 CTGGCGCTGGGTCGCGGTTCTGG + Intergenic
1077026250 11:441335-441357 CTGCTGCTGGATTCCGATTCTGG - Intronic
1077026258 11:441374-441396 CTGCTGCTGGATTCCGATTCTGG - Intronic
1077226421 11:1440792-1440814 CTGGTGCTAGAACACGTGTCAGG + Exonic
1077361184 11:2140757-2140779 CCGGTGCTGGCGCTCGTCTCCGG - Intronic
1077382412 11:2250303-2250325 CTGGTGCTGGCTGGTGTTTCAGG - Intergenic
1078132555 11:8624786-8624808 CTGGAGCTGGACCCAGTTTCTGG + Exonic
1079141919 11:17816754-17816776 CTGATTCTGGATCTTGTCTCAGG - Intronic
1090398577 11:126434619-126434641 CTGGTCCTGATTCTCTTTTCTGG + Intronic
1092002690 12:5044830-5044852 CTGGCGCTGGAACTCGTTGCGGG - Exonic
1092678669 12:10952322-10952344 CTTGTGCTGGATTTCATTTCAGG - Intronic
1097246109 12:57608689-57608711 CTTGTGGTGGATGTCGTTCCAGG - Exonic
1098027260 12:66216976-66216998 CTGGTTCTAGATCTCTTTTGGGG + Intronic
1101452377 12:104791039-104791061 CTGGAGCTGTATCTGGTCTCTGG + Intergenic
1101525545 12:105525382-105525404 CTGGTCCTTGATCTGGTTGCTGG - Intergenic
1102758298 12:115362989-115363011 CTTTTGCTGGTTCTCATTTCAGG + Intergenic
1104346496 12:128004447-128004469 CTGGTTCTGGGTCTGGTTTTGGG - Intergenic
1104892308 12:132146116-132146138 CTGGTACAGGATTTCTTTTCGGG - Intronic
1105633598 13:22196305-22196327 CTGGTGGTGGATCTCCTCTTTGG - Intergenic
1110686697 13:78383944-78383966 CTGGTGATGGATCTCTTTTTTGG - Intergenic
1112467325 13:99655375-99655397 CTGGTGTTGCATTTCGTTACTGG + Intronic
1119095373 14:71825071-71825093 TTGTTTCTGGATCTCGTTGCAGG + Intergenic
1119966862 14:78926178-78926200 TTGGTGCTGGCTGTGGTTTCAGG - Intronic
1120010942 14:79413540-79413562 CTGGTCTTGGATCTAGTTTTAGG - Intronic
1126025118 15:44438916-44438938 CTGGTTCAAGATCTCCTTTCAGG - Intronic
1127327799 15:57912337-57912359 CAGGTGCTGCCTCTGGTTTCTGG + Intergenic
1128565880 15:68700178-68700200 CTGGGTCTGGATGTCGTGTCTGG - Intronic
1132938848 16:2497035-2497057 CAGGAGCTGGATCTCCTTGCGGG - Exonic
1133062526 16:3183920-3183942 GTAGTGCTGGATCCCATTTCAGG + Intergenic
1136702760 16:32158420-32158442 CAGGTGCTGGTACTTGTTTCAGG - Intergenic
1136764939 16:32769176-32769198 CAGGTGCTGGTACTTGTTTCAGG + Intergenic
1136803160 16:33101208-33101230 CAGGTGCTGGTACTTGTTTCAGG - Intergenic
1137246875 16:46712827-46712849 GTGGTGCTGGGGCTCATTTCTGG + Intronic
1137699597 16:50487688-50487710 CTGGAGATGGATTTAGTTTCAGG + Intergenic
1140499360 16:75420003-75420025 CTGGGTCTGGATCCCCTTTCAGG + Intronic
1140719496 16:77758532-77758554 CTAGTTCTGGATCTAGTCTCTGG + Intergenic
1140719504 16:77758605-77758627 CTGGTTCTGGATCTAGTCTCTGG + Intergenic
1141130518 16:81433295-81433317 CAGGTGCTGGATACCGTTTGTGG - Intergenic
1203067296 16_KI270728v1_random:1031301-1031323 CAGGTGCTGGTACTTGTTTCAGG + Intergenic
1153929587 18:9866633-9866655 CTGGGGCTGGATCCCTTTCCAGG + Intergenic
1161868567 19:6853049-6853071 CTGCTGATGGTTCTCTTTTCAGG - Exonic
1168278362 19:55289484-55289506 CTGGTTCTGGAGCACGTCTCGGG + Exonic
1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG + Intronic
925744581 2:7033316-7033338 CTGGTGCTTGATCTGGCTGCTGG + Intronic
926201265 2:10800198-10800220 CTGCTGCTGGATCTTGGTACCGG + Intronic
926828530 2:16934480-16934502 CTGGTGATGAATCTCATTTTAGG + Intergenic
927937098 2:27082278-27082300 CTGGTGCTGGATCTCATTGAGGG - Exonic
929977324 2:46647426-46647448 CTGGAGTTGTATCTAGTTTCCGG - Intergenic
930937405 2:56970505-56970527 CTGGTGCTGGGTCTCGCTTGTGG - Intergenic
935792059 2:106601782-106601804 CTGTTGGTGGATCTCTATTCTGG + Intergenic
945537542 2:211037180-211037202 CTGGTACTTGATTTAGTTTCTGG + Intergenic
945819142 2:214641747-214641769 CTGGGGCTGGAAGTTGTTTCTGG + Intergenic
1171194686 20:23187711-23187733 CTCTTGCTGGGTCTGGTTTCAGG - Intergenic
1172070799 20:32255441-32255463 CTGGTGATGACTCACGTTTCTGG + Intergenic
1177033077 21:16007059-16007081 TTTGTGCTGAATCTCTTTTCTGG + Intergenic
1182717891 22:32374153-32374175 CTAGAGCTGGATTTAGTTTCTGG + Intronic
950442040 3:13015890-13015912 CTGGTGCCTGATCGTGTTTCAGG + Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
958884071 3:99706502-99706524 CTAGTGCTGGAACTCTTTTTAGG - Intronic
963257307 3:143158707-143158729 CAGCTGTTGGATCTTGTTTCGGG + Intergenic
964409357 3:156382172-156382194 CAGGTTCTGGATCTCACTTCTGG - Intronic
967261712 3:187649067-187649089 CTGGATCTGGATCTCTTTTTTGG + Intergenic
967934664 3:194717339-194717361 CTGGTTCTGGGTCTCTTTTTTGG - Intergenic
968392066 4:201794-201816 CTGGTGCTGAATCTCTTCCCAGG - Intergenic
970989894 4:22200626-22200648 CTGGTATTGGATCTGGATTCTGG - Intergenic
971780013 4:31021300-31021322 GTGGTGATGAATCTAGTTTCTGG - Intronic
983024702 4:162720561-162720583 ATGGTGCTGGGTTTCTTTTCAGG - Intergenic
986342248 5:6800717-6800739 CTTGTGCTGGATTTCTTTTCAGG + Intergenic
986543783 5:8873671-8873693 GTGGTTCTGCATCTCATTTCTGG - Intergenic
992442354 5:76808130-76808152 TTGGTGGTGGATCTGGATTCAGG + Intergenic
999955741 5:156699750-156699772 CTGGTGCTGTCTCACCTTTCAGG - Intronic
1000490450 5:161906229-161906251 CTGTTTCTGGATCTAGTTTGAGG - Intergenic
1002864585 6:1109744-1109766 CTGGAGCTGGATTTGGCTTCAGG + Intergenic
1006700669 6:35970548-35970570 CTGTTGCTGGATCTAATTTCTGG + Intronic
1006706977 6:36028507-36028529 GTGGTGCTGGAGCTCGGTTCTGG + Intronic
1009513778 6:64587663-64587685 CTGGTGCTGGCTATCATTTTAGG + Intronic
1030649700 7:112103973-112103995 CTGGTCCTGCATATCCTTTCAGG + Intronic
1041831656 8:62161882-62161904 CAGGGGCTGGAGCTGGTTTCAGG - Intergenic
1047400045 8:124538840-124538862 CTGGTTCTTGATCTAGGTTCTGG - Intronic
1048432319 8:134381912-134381934 CTGCTGCTGGAACATGTTTCTGG - Intergenic
1049591557 8:143465181-143465203 CTGGCGCTGGAGCTCATTGCGGG - Intronic
1055293665 9:74812149-74812171 CTGAAGCTGGATCTAGTTCCAGG - Intronic
1058861084 9:109118771-109118793 CTGGTGCTGCCTCTCAGTTCAGG - Intronic
1061443112 9:130620292-130620314 CTGGTGATGTATCTTTTTTCAGG + Intronic