ID: 1168588434

View in Genome Browser
Species Human (GRCh38)
Location 19:57613707-57613729
Sequence CAGTGGCTATGGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168588434_1168588440 4 Left 1168588434 19:57613707-57613729 CCAGCATCCCTCCATAGCCACTG No data
Right 1168588440 19:57613734-57613756 GAGACCATTCTTCCACTCCATGG No data
1168588434_1168588442 14 Left 1168588434 19:57613707-57613729 CCAGCATCCCTCCATAGCCACTG No data
Right 1168588442 19:57613744-57613766 TTCCACTCCATGGCCCTGCCTGG No data
1168588434_1168588445 16 Left 1168588434 19:57613707-57613729 CCAGCATCCCTCCATAGCCACTG No data
Right 1168588445 19:57613746-57613768 CCACTCCATGGCCCTGCCTGGGG No data
1168588434_1168588443 15 Left 1168588434 19:57613707-57613729 CCAGCATCCCTCCATAGCCACTG No data
Right 1168588443 19:57613745-57613767 TCCACTCCATGGCCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168588434 Original CRISPR CAGTGGCTATGGAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr