ID: 1168591044

View in Genome Browser
Species Human (GRCh38)
Location 19:57634315-57634337
Sequence AGGTGAGGCTGAGCTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168591039_1168591044 -2 Left 1168591039 19:57634294-57634316 CCAGCTTTTGGAACTCCTTGGAG 0: 1
1: 0
2: 0
3: 21
4: 123
Right 1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG 0: 1
1: 0
2: 4
3: 31
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168591044 Original CRISPR AGGTGAGGCTGAGCTGGTTC AGG Intronic
900150868 1:1178913-1178935 AGGTGTGGCTGAGCTCGGCCTGG - Intronic
900175092 1:1288036-1288058 AGGTGAGGCTGGGCTGGCAGGGG + Exonic
900175104 1:1288069-1288091 AGGTGAGGCTGGGCTGGCCAGGG + Intronic
900229196 1:1547730-1547752 CGGGGAGGCTGAGCAGGTTTCGG + Intronic
900372956 1:2340376-2340398 AGGGGAGGCTGAGCTGGAGGAGG - Intronic
900389363 1:2427364-2427386 AGGGGCGGCTGAGCTGGGGCGGG - Intronic
900460397 1:2799935-2799957 GGGTGAGGCTGTGCTGGGGCTGG - Intronic
900533711 1:3167091-3167113 AGGGAAGGCTCAGCTGGTGCTGG + Intronic
901756780 1:11446207-11446229 AGGAGAGGCTGAGCTGGGGTGGG - Intergenic
902148860 1:14426099-14426121 CAGTGAGGCTGAGCTGATTCAGG - Intergenic
902213453 1:14920356-14920378 TGGGGAGGCTGCTCTGGTTCTGG - Intronic
902235504 1:15054850-15054872 GTGTGAGGCTGAGCTGGGGCCGG - Intronic
902819987 1:18937905-18937927 AAGAGAGGCTGTGCTGGTGCCGG - Intronic
903161298 1:21491040-21491062 TGGTGAGGCTGAGCCAGTCCTGG + Intergenic
904214201 1:28906470-28906492 AGCTGAGGCTTTGCTGGATCAGG + Intronic
908146289 1:61248143-61248165 AGTTGAGGGTGAGCTAGTTGAGG - Intronic
908581937 1:65525620-65525642 AGGTGGGGCTGAGCAGGAGCAGG - Intronic
911151492 1:94600694-94600716 AGGTGAGGCTGCCCTGCTCCTGG - Intergenic
915484403 1:156210325-156210347 AGGTGTGGCTGAGATGATTCTGG - Exonic
915894529 1:159801450-159801472 AGCTGAGACTGAGCTGGGTCTGG - Intronic
915894767 1:159803228-159803250 GGCTGAGACTGAGCTGGGTCTGG - Intronic
917587510 1:176442704-176442726 AGCTGAGCTAGAGCTGGTTCTGG - Intergenic
918639205 1:186818302-186818324 AGGTGAGGCTGACTTGAATCAGG + Intergenic
918773817 1:188601947-188601969 ATGTGAGGCTGAGGTAGTGCTGG - Intergenic
919803039 1:201364938-201364960 AGCTGAGTCTGATCTGTTTCAGG - Intronic
923437354 1:233979922-233979944 TGGTGAGGCTGAGGTGGGTTTGG + Intronic
924618357 1:245634946-245634968 ATGGGAGGCTGAGGTGCTTCAGG - Intronic
1064031713 10:11887083-11887105 ACGAGAGGCTGGGCTGCTTCTGG - Intergenic
1065916487 10:30358101-30358123 AGGGGAGCCTCAGCTGGTTGGGG - Intronic
1067057000 10:43058238-43058260 AGGTGATGGTGAGCAGGTTTTGG - Intergenic
1069580653 10:69563861-69563883 AGGTGTGGCTTAGCTGGTTCAGG - Intergenic
1070920869 10:80185262-80185284 AAGTGAGGCTGAGCTAGGCCTGG - Intronic
1071541218 10:86485955-86485977 TGTTGAAGCTGAGCAGGTTCTGG - Intronic
1073730503 10:106281889-106281911 AGGTGGGGCTGAGGTGGGTTGGG - Intergenic
1075396789 10:122133395-122133417 AGCTGACTCTGAGCTGATTCTGG - Intronic
1075780331 10:125013203-125013225 AGGTGAGGCTGAGCAGATGGTGG - Intronic
1076023337 10:127092243-127092265 AGAGGAGGATGAGCTGGATCGGG + Intronic
1076188448 10:128466638-128466660 GGGAGAAGCTGAGCTGGCTCTGG + Intergenic
1078777824 11:14410074-14410096 AGGTGGGGCAGAGCTGGAGCAGG + Intergenic
1079102288 11:17549231-17549253 AGCTGAGGCTCAGCTGCTTTGGG - Intronic
1079346036 11:19653091-19653113 AGGAGAGGCTGAGCTGAATGGGG - Intronic
1079361514 11:19774114-19774136 AGGTGATGCTGACCTGCTTCTGG - Intronic
1080888778 11:36390309-36390331 AGGTGGGGCAGAGCAGGTGCTGG + Intronic
1081759410 11:45566820-45566842 AGGTGAGGCTGAGGTTGTGCTGG + Intergenic
1081871369 11:46384093-46384115 GGGTGAGGCTGAGATGGGTGTGG - Intergenic
1083278345 11:61610286-61610308 AGGTGAGGCTGACCAGGTGTTGG + Intergenic
1083452040 11:62752755-62752777 AGCTGAAGCTGAGCTGGTCCAGG - Exonic
1083658757 11:64242386-64242408 ACATGAGGCTGAGCTGGTTCCGG + Exonic
1083777384 11:64900863-64900885 AGGTGAGGAGGAGCGGGTGCAGG - Exonic
1083878270 11:65536140-65536162 AGGTGAGGCACAGCTGGGCCTGG + Exonic
1083935918 11:65870100-65870122 TGGTGAGGCTGGGCTGGGCCAGG - Exonic
1084941191 11:72614280-72614302 CAATGAGGCTGAGCTGGATCAGG + Intronic
1088194970 11:107264282-107264304 AGGTGAGCCTGAGATGGGGCTGG - Intergenic
1089459795 11:118645824-118645846 GGGTGAGTCTGACCTGGATCGGG + Exonic
1090255545 11:125281188-125281210 AGGTGGCTCTGAGCTGGTGCTGG - Intronic
1090344043 11:126053088-126053110 AGGTTCTGCTGAGTTGGTTCTGG - Intronic
1091592647 12:1854024-1854046 AGGTGACGAGGAGCTGGTCCGGG - Exonic
1094661160 12:32471828-32471850 AAATGATGCTGTGCTGGTTCTGG - Intronic
1095730119 12:45497570-45497592 AGGTGTGGGTGGGCTAGTTCTGG - Intergenic
1096152042 12:49320510-49320532 AGGTGAGACTGAGGTGGATTAGG + Intergenic
1096672053 12:53205900-53205922 CGCTGAGGCTGAGCTGGGACTGG - Intronic
1097186120 12:57197422-57197444 AAGGGAGGCTGTGCTGGGTCTGG - Intronic
1097187859 12:57205161-57205183 AGGAGAGGCAGCGCTGGTTCCGG - Exonic
1097290299 12:57908780-57908802 AGGTGAGGCAGGGCTGATCCAGG + Intergenic
1097566090 12:61270065-61270087 AGGTGGGCTTGAGCTGGTTATGG - Intergenic
1100611777 12:96195973-96195995 AGGGGAGGCTGAGTTGTTTTTGG + Intronic
1100979472 12:100153514-100153536 AGGGGAGCCTCAGCTGGTTGGGG - Intergenic
1103011505 12:117461747-117461769 AGGTGAGGGTGAGGTGGTACGGG + Exonic
1103465870 12:121141480-121141502 AGGCGAGGCTGAGGTGGGGCTGG + Intronic
1103859587 12:124001623-124001645 AAGTGAGGCTGACCTGGTCAGGG - Intronic
1104609806 12:130218860-130218882 AGGTGAGGCTGAGCTTGCACGGG + Intergenic
1104634518 12:130429227-130429249 TGCTGAGGCTGAGCTGGGCCCGG - Intronic
1104675348 12:130708824-130708846 AGCTGGGGCGGAGCCGGTTCTGG - Intronic
1106579796 13:31007613-31007635 AGGTGTGTGTGAGCTGGTGCAGG + Intergenic
1112611746 13:100962092-100962114 AGGTAAACCTGAGCTGGTTGGGG + Intergenic
1113038808 13:106081900-106081922 AGGTGATCCAGTGCTGGTTCTGG - Intergenic
1113972668 13:114201726-114201748 AGGGGAGTCTCAGCTGCTTCTGG + Intergenic
1114405067 14:22448966-22448988 AGGTCAGGCCAAGCTGGCTCAGG - Intergenic
1114629659 14:24150910-24150932 AGGTAGGGCTGAGCTGGTCTGGG + Intronic
1116118247 14:40685397-40685419 AATTGCAGCTGAGCTGGTTCAGG - Intergenic
1117042280 14:51778237-51778259 AGGTAGGGCTGAGCTGGGTATGG - Intergenic
1118940585 14:70332627-70332649 AGCTGAGACTGAGCTGCCTCGGG - Intronic
1121611264 14:95282510-95282532 AATGCAGGCTGAGCTGGTTCAGG + Intronic
1122146079 14:99689571-99689593 AGATGAGGAGGAGCTGGTTGGGG - Intronic
1123087163 14:105722048-105722070 AGGTGAGGGTGCGCTTGTCCCGG + Intergenic
1124210803 15:27763753-27763775 AGGTGAGGTTGCCCTGGTACTGG + Intronic
1124818702 15:33021214-33021236 AGGTTCAGCTGAGCTGGTTTGGG - Intronic
1125202306 15:37110823-37110845 AGCTGGGGGTGAGCTGGCTCGGG + Intergenic
1128230295 15:66029937-66029959 AGCAGAGGATGAGCTGGTGCTGG - Intronic
1128379415 15:67101038-67101060 AGGTGAGGCTCAGGAGGCTCTGG + Intronic
1128996980 15:72304585-72304607 AGGGAAGGCTGAGCTATTTCTGG + Intronic
1129078681 15:73020556-73020578 AGGTGGTGCAGAGGTGGTTCAGG + Intergenic
1129210335 15:74064596-74064618 AGGGGAGCCTCAGCTGGTTGTGG - Intergenic
1129840354 15:78739773-78739795 AGGGGAGCCTCAGCTGGTTGCGG + Intergenic
1130781734 15:87046979-87047001 AAGTGACGCTGTGCTAGTTCTGG + Intergenic
1130830026 15:87589946-87589968 AGGTGAAGTTGGGGTGGTTCAGG - Intergenic
1132408893 15:101561909-101561931 AGGTGAGGCTGAGTTGGGACTGG - Intergenic
1132556206 16:573822-573844 GGGTGGGGCTGAGCTGGGCCTGG + Intronic
1132567837 16:631352-631374 GGTTGGGGCTGAGCTGGTTGGGG - Exonic
1132656737 16:1044611-1044633 AGGTGGCCCTGAGCTGGTGCTGG + Intergenic
1134057255 16:11178349-11178371 AGGTGAGGCTTAGGCAGTTCTGG - Exonic
1136612054 16:31372240-31372262 CGGTGACGCTGAGCAGGCTCTGG + Intronic
1139395094 16:66632587-66632609 AAGTGGGGCTGAGCTGGCCCTGG + Intronic
1140859511 16:79006685-79006707 AGGTGGGGCTGGGCTTTTTCTGG + Intronic
1140912754 16:79468594-79468616 AGCTGGGGCTGAGCAGGTTAAGG - Intergenic
1141580446 16:84994556-84994578 AGGCGGAGCTGAGCTGGCTCAGG - Intronic
1142024622 16:87805881-87805903 AGGTGCAGCTCACCTGGTTCTGG + Intergenic
1143114649 17:4575771-4575793 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1143124582 17:4633321-4633343 AAGTGAGGGTGAGCAGGGTCAGG + Intronic
1143564763 17:7714917-7714939 GGGGGAGACTGAGCTGCTTCAGG + Intergenic
1144631423 17:16874411-16874433 CGGGGAGGCTGAGCTGGGTTAGG + Intergenic
1144765667 17:17731160-17731182 GGGTCAGGCTGACCCGGTTCAGG - Intronic
1146521217 17:33527006-33527028 GGGTGATGCTGGGCTGGCTCAGG + Intronic
1146689787 17:34865438-34865460 ATGTGAGGCTGAGGTGCTACAGG + Intergenic
1147137119 17:38440869-38440891 AGGAGAGGCTGACCTGGTGCTGG + Intronic
1147951836 17:44111788-44111810 AGCTGAGGCTGAGCAGCCTCTGG - Intronic
1148821177 17:50360520-50360542 AGGTGAGGAAGAGCTGGGTGTGG - Exonic
1151364034 17:73605589-73605611 AGGTGATGCTGGGCTGACTCAGG - Intronic
1153985086 18:10344228-10344250 AGCTGAGGCTGCACAGGTTCAGG - Intergenic
1155390222 18:25327925-25327947 AGTTGAGGCCGATGTGGTTCCGG - Intronic
1155768812 18:29671943-29671965 AGGTGGGGCTGAGGTGGCTGGGG - Intergenic
1157558926 18:48632560-48632582 AGGGGAGGCTGAACTGGCCCAGG - Intronic
1159876485 18:73816979-73817001 AGGTGAGACTTAGCTGGGTGTGG - Intergenic
1161040786 19:2109822-2109844 AGGGGAGGCGGAGGGGGTTCGGG + Intronic
1161118362 19:2511902-2511924 AGGGGAGGCGGAGCTGGTCCGGG + Exonic
1161507108 19:4649988-4650010 AGTGGAGGCTGAGCAGGGTCTGG + Intronic
1161542582 19:4861060-4861082 AGGTGAGGATGATTTGGCTCAGG + Intronic
1162359080 19:10206762-10206784 AGGTGAGGGTGACCTGGGCCAGG - Intronic
1162401227 19:10447828-10447850 GGAAGAGGCTGAGCAGGTTCAGG - Intronic
1162421513 19:10568492-10568514 AGGTGAGGCCGGGCCGGTCCAGG - Exonic
1163724707 19:18915958-18915980 AGGTGGGGCTGAGGTTGCTCAGG + Intronic
1164619017 19:29682744-29682766 AGGTGAGGAAGAGGAGGTTCCGG - Intergenic
1165358285 19:35317654-35317676 AGGTCAGGCTGTGCTGGGTCAGG + Intergenic
1165860946 19:38909070-38909092 AGGTGAGTCTGAGCTGGGCCGGG - Exonic
1166264219 19:41667642-41667664 AGGATAGGATCAGCTGGTTCAGG - Intronic
1166532349 19:43550687-43550709 AGGTGAGGCTGAGCTTACACAGG - Intronic
1167569929 19:50280592-50280614 AGCTGGGGCTGAGCTGGAGCTGG - Intronic
1168375869 19:55878863-55878885 AGGTCAGGTTGAGCTGCTGCAGG - Exonic
1168544981 19:57242660-57242682 GGGAGAGGATGAGCTGGTCCAGG + Intronic
1168583925 19:57577788-57577810 AGGTCAGGCTGAGCTGGTTTAGG - Intronic
1168585085 19:57585220-57585242 CAGTGAAGCTGAGCTGATTCAGG + Intronic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
924985984 2:270372-270394 AGGTGAGGCTGCGATGCTTCAGG - Intronic
925073658 2:991716-991738 AGGGAAGGCACAGCTGGTTCAGG + Intronic
925379353 2:3414503-3414525 GGGTGAGGCTGAGCTGGAGCTGG - Intronic
925380099 2:3418882-3418904 AGGTGAGGCAGAGGAGGGTCGGG - Intronic
926354128 2:12024093-12024115 TTGTGAGGCTGAGCTGAATCAGG - Intergenic
926441688 2:12895604-12895626 AGGAGATGCAGAGATGGTTCTGG + Intergenic
928097531 2:28413626-28413648 AGGACAGGCTGAGCGGGTGCTGG - Exonic
931149079 2:59552753-59552775 GAGTGTGGCTGAGCTGATTCTGG + Intergenic
932311132 2:70742354-70742376 AGATGTAGCTGAGCTGTTTCTGG - Intronic
932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG + Intronic
934553799 2:95277146-95277168 AGGTGGGGCAGAGGTGGCTCAGG - Intronic
935213335 2:100956724-100956746 GGGTGAGGCTGAGCTGGAGAGGG + Intronic
935329618 2:101967263-101967285 AAGTCAGGCTTAGCTGGATCTGG + Intergenic
935356764 2:102208608-102208630 AGGGGAGACTGAGCTATTTCTGG + Intronic
935736384 2:106109851-106109873 ACGAGACGCTGAGCTGTTTCTGG + Intronic
938427249 2:131202315-131202337 AGGTGAGGGTGAGTGGGCTCCGG + Intronic
939161591 2:138596524-138596546 GGTTCAGACTGAGCTGGTTCTGG - Intergenic
942951196 2:181723833-181723855 AAGTGATGCTGAGCCAGTTCTGG - Intergenic
946047086 2:216830137-216830159 AGGTGAGTCTCTTCTGGTTCAGG + Intergenic
946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG + Exonic
946745472 2:222841123-222841145 AGGGAAGGCTGGGCTGGGTCGGG + Intergenic
948449570 2:238060865-238060887 AGGCGAGGCTGCGCTGGGTCAGG - Intronic
948468948 2:238165286-238165308 AGGTGATGCTAAGTTAGTTCAGG - Intronic
949034728 2:241811224-241811246 AGGGGAGCCTGTGCTGGTCCCGG + Exonic
1168802282 20:651336-651358 AGCAAAGGCAGAGCTGGTTCTGG + Intronic
1170141124 20:13125787-13125809 AGGTGATGGTGTGGTGGTTCTGG - Intronic
1170159398 20:13296638-13296660 AGGAGGGGCTGTGCTGGTTTAGG + Intronic
1170373950 20:15679543-15679565 AAGTGATGCTGTGCAGGTTCTGG + Intronic
1170828678 20:19820604-19820626 ACCTGAGGCTGGGCTGGCTCAGG - Intergenic
1172080921 20:32339996-32340018 GGGTGTGGCTGAGCTGGATTGGG + Intergenic
1172312886 20:33931883-33931905 AGGTGGGGTGGGGCTGGTTCTGG + Intergenic
1172823670 20:37761423-37761445 AGGTGAGGCTGAGGTTGGCCAGG + Intronic
1173329918 20:42067233-42067255 AGCTTAGGCAGAGCTGGTACGGG + Intergenic
1173564353 20:44028341-44028363 GGGTGGGGCTGGACTGGTTCTGG + Intronic
1173988440 20:47280867-47280889 GGCTGAGGCTGAGAGGGTTCAGG - Intronic
1174053595 20:47784140-47784162 AGGGGAGGCTGCGCTGGAGCAGG - Intronic
1175108025 20:56628414-56628436 AGGTGAGGGTGAGGAGGTGCAGG - Intergenic
1175414868 20:58794656-58794678 GGCTGAGGCTGGGCTGGCTCCGG - Intergenic
1175689772 20:61056979-61057001 GGGTGAGGCTGGGCTGCTGCTGG - Intergenic
1175689777 20:61057000-61057022 GGGTGAGGCTGGGCTGCTGCTGG - Intergenic
1175935894 20:62513828-62513850 GGGGGAGGCTGAGCTGGCACAGG + Intergenic
1178092084 21:29174757-29174779 GGATGCTGCTGAGCTGGTTCGGG + Exonic
1178944203 21:36932825-36932847 AGTTGAGGCTTAGCTGGGTGTGG + Intronic
1180076451 21:45465752-45465774 GAGTCAGGCTGGGCTGGTTCTGG + Intronic
1180205475 21:46256776-46256798 AGCTGATGCTGACCTGGTGCAGG + Exonic
1181341085 22:22180512-22180534 AAGTGAGCATGTGCTGGTTCTGG - Intergenic
1182541838 22:31047456-31047478 AGGTGAGACTGAGCTGTGTCTGG + Intergenic
1184592805 22:45496440-45496462 AGGTGAGGCTGAGGTGCACCTGG + Intergenic
1184654520 22:45934405-45934427 TAGGGAGGCTGAGCTGGCTCTGG + Intronic
1184880409 22:47300831-47300853 CGGTGAGGCTGGGCTGGGGCAGG - Intergenic
1185194555 22:49460916-49460938 AAGTGAGGATGAGCTGGGTGCGG - Intronic
1185226454 22:49656473-49656495 GGGTGAGGCTGTGCTGGTCAGGG - Intronic
950222870 3:11209809-11209831 AGCTGAGGCTCAGCTAGTACAGG + Intronic
950538021 3:13592874-13592896 AGGTGTGGCTGAGCTCGCTCAGG + Intronic
951544029 3:23807292-23807314 AGATGAGGAGGAGCTGGTGCTGG - Exonic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
953636264 3:44667844-44667866 AGTGGAGGCTGAGCTGGTGAGGG + Intergenic
953656077 3:44855927-44855949 AGTTGAGGCTGAGCTTGGTGAGG + Intronic
953821167 3:46208607-46208629 AGGTGAAGCTGAGTTGGGTGAGG + Intronic
954309787 3:49756958-49756980 AGGTGAGACTTAGCTGATTCAGG - Intronic
954634562 3:52064548-52064570 AGGAGGGGCTGGGCTGGGTCAGG + Intergenic
955921787 3:63964745-63964767 AGGTGAAGCTAATCTGATTCTGG + Intronic
956140771 3:66144533-66144555 AGCTGAGGATTAGCTGGTTGTGG + Intronic
958126763 3:89366233-89366255 TGTTGATGCTGAGTTGGTTCTGG - Intronic
961012835 3:123447816-123447838 TGGTGAGGCTGCTCTGGTTCAGG + Exonic
961135329 3:124504802-124504824 TGGTGGGGCTGAACTGGTTCTGG - Intronic
961387529 3:126530841-126530863 AGAGGAGGCTGAGGAGGTTCAGG - Intronic
962082543 3:132155902-132155924 AGTTGTGGCAGAGCTGGATCTGG + Intronic
963273313 3:143306643-143306665 AGGTGCTGCTGACCTGGGTCAGG - Intronic
964512119 3:157464183-157464205 AGGTGAGACTGAGATGTTTGGGG - Intronic
965841562 3:172911327-172911349 AGGTGCTGCTCAGCTGGTACTGG - Intronic
966377915 3:179315915-179315937 AGGTGGGGGTGAGGTGGGTCAGG - Intergenic
966780633 3:183581146-183581168 AGGAGTGTCTGAGCTGGTGCGGG - Intergenic
966862903 3:184240637-184240659 TGGGGAGTCTGAGCTGGTTCTGG + Intronic
968477682 4:820154-820176 AGGCTGGGCTGAGCTGGGTCCGG - Intronic
968477693 4:820194-820216 AGGCTGGGCTGAGCTGGGTCCGG - Intronic
968477704 4:820234-820256 AGGCTGGGCTGAGCTGGGTCCGG - Intronic
971303020 4:25457285-25457307 AGGAGAGGCTTAGCAGGGTCCGG - Intergenic
972923291 4:43970354-43970376 AGGAGAGGGTGAGCTGAGTCAGG - Intergenic
973589522 4:52426765-52426787 TGGTGAGGATGTGCTGATTCAGG - Intergenic
974740911 4:66006752-66006774 AGATGAGGCTAAGCTTCTTCAGG - Intergenic
977683143 4:99816985-99817007 TGGAGAGGCTGAGCTGCTCCAGG + Exonic
983222931 4:165060045-165060067 AGGTTAGGGTGTGCTGTTTCAGG - Intergenic
983693307 4:170498901-170498923 AAGTGAGGCTCAGCTGGTGGAGG + Intergenic
984934576 4:184879023-184879045 AGGTGAGGAGGAGCTGGCTGCGG - Intergenic
985177913 4:187222094-187222116 AGGTGATGGGGAGCTGATTCTGG + Intergenic
986140412 5:5025042-5025064 CAGTGAGGCTGTGCTGGTTGTGG + Intergenic
986214638 5:5708021-5708043 TGGTGGGGCTGAGCTCCTTCTGG + Intergenic
990103844 5:52230737-52230759 AGGTGAGCCTGCCCTTGTTCTGG + Intergenic
990272773 5:54162310-54162332 AGGTGAGGCTGAGTTGGCCATGG - Intronic
991019122 5:61961805-61961827 TGGTGAGGGTGAGTTGGTTCTGG - Intergenic
994042571 5:95274971-95274993 AGGTGAGGCTGCAGTGGTTGCGG - Intronic
995590441 5:113693928-113693950 GGTTGAGGCTGAGCTGTTTAAGG + Intergenic
996215149 5:120856928-120856950 AGCTGAGGGTCAGCTGATTCAGG + Intergenic
996342896 5:122457675-122457697 AGGCGAGGCTGAGGTGGGTGTGG - Intronic
996810714 5:127513853-127513875 AGTAGAGGCAGAGCTGATTCTGG - Intergenic
998092599 5:139380027-139380049 AGGTGAGGTTGCGCAGGTACTGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998352578 5:141511210-141511232 AGGAGAAGCTGGGCTGGTTGGGG - Exonic
999228667 5:150048565-150048587 AGGAGAAGCAGAGCTGGTCCTGG - Exonic
999328896 5:150659757-150659779 AGGTGAGGCTAAGCTTGCCCTGG + Intergenic
999376571 5:151090908-151090930 GGGGGAGGATGTGCTGGTTCTGG - Intronic
999539018 5:152551291-152551313 AGGTGATGCTATGCTGGTTCTGG - Intergenic
1001284648 5:170413757-170413779 AGGGGAGGCTGGGCTGGTGGAGG - Intronic
1001454852 5:171852751-171852773 AAGTCAGGCTGAGCTGGCACTGG - Intergenic
1001561375 5:172671271-172671293 GGTCGAGGCTGGGCTGGTTCCGG - Intronic
1001845488 5:174917737-174917759 AGGGGAGCCTCAGCTGGTTGGGG - Intergenic
1002113159 5:176934935-176934957 GGCTTAGGCTGAGCTGGATCTGG - Intronic
1002159638 5:177307644-177307666 GGGTGAGGCCGAGCTGCTGCGGG - Exonic
1002210332 5:177595229-177595251 AGGTGAGCCTGAGTTGGCTGGGG - Intronic
1002522200 5:179798144-179798166 AGGTGAGGCTGGGCAGGGCCAGG - Exonic
1004966407 6:20856706-20856728 AGCTGAGGCTGATCTGTCTCTGG + Intronic
1005118315 6:22363058-22363080 GTCTGAGGCTGAGCTGGATCTGG - Intergenic
1005272544 6:24181362-24181384 AGGAGAGGGTGAGATGGGTCTGG - Intronic
1005450377 6:25966300-25966322 AGTTGAGGCTGAGGTTGTTTGGG - Intronic
1005510559 6:26508518-26508540 AGGTGGGGATGAGCTGTGTCTGG - Exonic
1005914622 6:30341729-30341751 AGGTTAGGATGAGCTGTCTCAGG - Exonic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1006442025 6:34058953-34058975 AGGTAAGGCTGGGCGGGTGCAGG - Exonic
1006456414 6:34134502-34134524 AGCTGAGGCTGTGGGGGTTCTGG + Intronic
1008590700 6:52990785-52990807 AAGTGAAGTTGAGCAGGTTCAGG + Intronic
1015285965 6:131486903-131486925 AGGTGAGGCTGGTGTTGTTCAGG - Intergenic
1018456988 6:163961815-163961837 GGGTGAGGCTGGGCTGATTCAGG + Intergenic
1018690083 6:166337581-166337603 AGGTGTGGGTGAGGTGGTTAGGG - Intronic
1019193579 6:170268197-170268219 AGATGAGGTTGAGCTGGATGAGG + Intergenic
1019514277 7:1432932-1432954 AGGTGAGGCGGAGCGGGTGATGG - Intronic
1019800400 7:3084243-3084265 GTGAGATGCTGAGCTGGTTCTGG + Intergenic
1020005933 7:4783797-4783819 AGGTGAGGCTGGGACTGTTCTGG + Exonic
1023320991 7:38997468-38997490 AGATGAGGCCAGGCTGGTTCAGG - Intronic
1023838614 7:44082769-44082791 AGGAGAGGCTGGGCTGGAGCGGG + Intergenic
1026331492 7:69356046-69356068 ATGTGAGGCTGAGTTGTTTCTGG - Intergenic
1026738836 7:72965860-72965882 AGAAAAGGCTGAGCGGGTTCCGG + Exonic
1026789845 7:73324490-73324512 AGAAAAGGCTGAGCGGGTTCCGG + Exonic
1027104898 7:75399209-75399231 AGAAAAGGCTGAGCGGGTTCCGG - Exonic
1031987641 7:128173538-128173560 AGGCGAGGCTGGGCTGGGTTGGG - Intergenic
1032588422 7:133169960-133169982 TTGTGAGGCTGAGCTGAATCAGG + Intergenic
1033290624 7:140079706-140079728 ATGTGAGTCTGGGCTGGTTAGGG - Intergenic
1034850559 7:154489529-154489551 TTGTGATGCTGAGCAGGTTCTGG + Intronic
1034962079 7:155369124-155369146 AAGAGAGGCTGTGCTGCTTCTGG - Intergenic
1035486385 7:159229499-159229521 AGGTCAGGCTGAGTTGGTGAGGG + Intergenic
1036676764 8:10840198-10840220 CCGTGAGGCTGAGCTGCTTGAGG - Intergenic
1037435955 8:18863488-18863510 TGCAGAGGCTGAGCTGTTTCCGG + Intronic
1037465217 8:19153059-19153081 AGGTTAGAGTGTGCTGGTTCTGG - Intergenic
1037763476 8:21757232-21757254 AGGAGAGGCTGGGCTGGGTGTGG - Intronic
1040610638 8:48978261-48978283 AGGCCAGGCTGCGCTGGCTCTGG + Intergenic
1040680080 8:49798086-49798108 AGGACTGGTTGAGCTGGTTCTGG - Intergenic
1044834076 8:96278808-96278830 AGATAAGGCTGGGCTGGTTTTGG - Intronic
1045226843 8:100256039-100256061 AGGTGAGACTGAAGTGGTACTGG + Intronic
1047976117 8:130132499-130132521 AGGTAAGGCTGAGCTGGCTCAGG - Intronic
1048322176 8:133408540-133408562 TTGTGAGGCTGAGCTGAATCAGG - Intergenic
1048923627 8:139252046-139252068 AGGTGAGGCAGAGCTTGTGCAGG - Intergenic
1049201515 8:141342808-141342830 AGGTGAGGCTGAGCTGGGAAGGG + Intergenic
1049280177 8:141740149-141740171 TGGAGAGGCTGGGCTGGTTGGGG + Intergenic
1050388733 9:5114533-5114555 AGGTGAGGGTGCGCTTGTCCTGG - Intronic
1052475282 9:28951525-28951547 AGGTCAGAATAAGCTGGTTCTGG - Intergenic
1053294795 9:36905186-36905208 AAGTGAAGATGAGCTGGTCCAGG - Intronic
1054724485 9:68636765-68636787 AGGTGAAGCTGAGCTGTGTTTGG - Intergenic
1055839844 9:80490516-80490538 AGATGAGACTGACCTGGTTCTGG + Intergenic
1056601175 9:88048276-88048298 AGGTGGGGCTGAAGGGGTTCAGG - Intergenic
1057835963 9:98445605-98445627 AGGTGAGCCTCAGCCTGTTCTGG + Intronic
1058720772 9:107761487-107761509 GGGAGAGGCTGAGCAGGCTCCGG + Intergenic
1058998415 9:110322766-110322788 AGGAGAGGCTGAGCTGGCAGTGG + Intronic
1059389447 9:113989631-113989653 AGGTGAGCCAGAGCTGGACCAGG - Intronic
1061163388 9:128909069-128909091 AGGTGAGGCGGTGCAGGTGCTGG - Exonic
1061309329 9:129752109-129752131 AGGTGAGGCAAGGCTGGCTCTGG - Intronic
1062130167 9:134888306-134888328 TGGTCAGGCTGAGCTGGCTGGGG - Intergenic
1062732651 9:138118533-138118555 AGGTGAGACTGAGATGGATTTGG + Intronic
1185497852 X:571280-571302 CGGTGAGAATGAGCTGGCTCTGG + Intergenic
1191874899 X:65786756-65786778 AAGTGAGGGGGAGCTGGATCTGG + Intergenic
1193051993 X:77111584-77111606 CAGTGAGGAGGAGCTGGTTCAGG - Intergenic
1193431723 X:81414734-81414756 AGGTGGGGCTTAGATGTTTCGGG + Intergenic
1197149259 X:123202599-123202621 AGGTGAGGGGAAGCTGCTTCTGG - Intronic
1199724338 X:150566606-150566628 AGGTGGGGCTGGGCTGGGGCTGG + Intergenic
1199973594 X:152878092-152878114 AGGTCAGGCTGAGGAGGTGCTGG - Intergenic