ID: 1168592663

View in Genome Browser
Species Human (GRCh38)
Location 19:57650356-57650378
Sequence GTATAATTTTCGGCCGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168592659_1168592663 23 Left 1168592659 19:57650310-57650332 CCACAGTGTATATAGTTCACTGT No data
Right 1168592663 19:57650356-57650378 GTATAATTTTCGGCCGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168592663 Original CRISPR GTATAATTTTCGGCCGGGTG TGG Intergenic
No off target data available for this crispr