ID: 1168596442

View in Genome Browser
Species Human (GRCh38)
Location 19:57681715-57681737
Sequence GGGGCTTTTCCCAGATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168596442_1168596448 14 Left 1168596442 19:57681715-57681737 CCCAGAAATCTGGGAAAAGCCCC No data
Right 1168596448 19:57681752-57681774 AATACCTCCTTCTCCCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168596442 Original CRISPR GGGGCTTTTCCCAGATTTCT GGG (reversed) Intergenic
No off target data available for this crispr