ID: 1168605673

View in Genome Browser
Species Human (GRCh38)
Location 19:57758353-57758375
Sequence CTATCCTACTGTAGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2723
Summary {0: 8, 1: 137, 2: 465, 3: 926, 4: 1187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168605673_1168605679 5 Left 1168605673 19:57758353-57758375 CCAGCTCAGCTACAGTAGGATAG 0: 8
1: 137
2: 465
3: 926
4: 1187
Right 1168605679 19:57758381-57758403 CAGGCTGAGGCCCCTATTCTAGG No data
1168605673_1168605677 -8 Left 1168605673 19:57758353-57758375 CCAGCTCAGCTACAGTAGGATAG 0: 8
1: 137
2: 465
3: 926
4: 1187
Right 1168605677 19:57758368-57758390 TAGGATAGGGCACCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168605673 Original CRISPR CTATCCTACTGTAGCTGAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr