ID: 1168605679

View in Genome Browser
Species Human (GRCh38)
Location 19:57758381-57758403
Sequence CAGGCTGAGGCCCCTATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168605673_1168605679 5 Left 1168605673 19:57758353-57758375 CCAGCTCAGCTACAGTAGGATAG 0: 8
1: 137
2: 465
3: 926
4: 1187
Right 1168605679 19:57758381-57758403 CAGGCTGAGGCCCCTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168605679 Original CRISPR CAGGCTGAGGCCCCTATTCT AGG Intergenic
No off target data available for this crispr