ID: 1168607556

View in Genome Browser
Species Human (GRCh38)
Location 19:57771834-57771856
Sequence TTTTTTCCCAAGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1800
Summary {0: 1, 1: 2, 2: 18, 3: 161, 4: 1618}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168607556 Original CRISPR TTTTTTCCCAAGATGGAGTC TGG Intronic
900071899 1:778018-778040 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
900108205 1:994769-994791 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
900236278 1:1592830-1592852 TTTTTTATTTAGATGGAGTCTGG - Intergenic
900369550 1:2325317-2325339 TTCTTTCTCTAGATAGAGTCTGG + Intronic
901302127 1:8207431-8207453 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
901316012 1:8309029-8309051 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
901352222 1:8607735-8607757 TTTTTTTTTGAGATGGAGTCTGG + Intronic
901551672 1:9999827-9999849 TTTTTTTTTTAGATGGAGTCTGG + Intronic
901805185 1:11734296-11734318 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
901840966 1:11953779-11953801 TTTTTTTTTGAGATGGAGTCTGG - Intronic
902097468 1:13958560-13958582 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
902354970 1:15891361-15891383 TTTTTTTTTGAGATGGAGTCTGG + Intronic
902603766 1:17557329-17557351 TTTTTTTTTGAGATGGAGTCTGG - Intronic
903064828 1:20693560-20693582 TGTCTTCCCAAGGTGGAGGCTGG - Intronic
903080147 1:20804203-20804225 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
903205242 1:21777100-21777122 TTTTTTTTTCAGATGGAGTCTGG - Intronic
903484609 1:23680417-23680439 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
903603778 1:24560147-24560169 TTTTTTTTTGAGATGGAGTCTGG - Intronic
903616623 1:24664005-24664027 TTTTTTGTTGAGATGGAGTCTGG + Intronic
903901589 1:26650110-26650132 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
904115478 1:28158684-28158706 TTTTTTTTTAAGATGGAGTCTGG - Intronic
904118872 1:28182494-28182516 GTTTTTGTAAAGATGGAGTCTGG - Intronic
904136266 1:28314974-28314996 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
904145636 1:28388836-28388858 TTTTTTTTTGAGATGGAGTCTGG - Intronic
904166338 1:28558226-28558248 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904277552 1:29394286-29394308 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
904513370 1:31033216-31033238 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904655337 1:32041599-32041621 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904661408 1:32088112-32088134 TTTTTTTTGGAGATGGAGTCTGG - Intronic
904707811 1:32404655-32404677 TTTTTTCCCAAAAGGGAGACTGG + Intergenic
904737816 1:32648668-32648690 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904904976 1:33890240-33890262 TTTTTTTTTGAGATGGAGTCTGG + Intronic
905083723 1:35350209-35350231 TTTTTTTTCAAGATGGAGTCAGG - Intronic
905368727 1:37471259-37471281 TTTATTTTCGAGATGGAGTCTGG - Intergenic
905432564 1:37935187-37935209 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905561027 1:38927413-38927435 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905592142 1:39173325-39173347 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905618124 1:39415337-39415359 TTTTTTTTTTAGATGGAGTCTGG + Exonic
906045773 1:42829984-42830006 TCTTTGCCCAAGATGCAGCCTGG - Intronic
906379180 1:45321023-45321045 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
906408355 1:45559997-45560019 TTTTTTTTTGAGATGGAGTCTGG + Intronic
907002143 1:50872051-50872073 TTTTTTTTTGAGATGGAGTCTGG - Intronic
907204147 1:52754035-52754057 TTTTTTTTTGAGATGGAGTCTGG + Intronic
907449370 1:54533629-54533651 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
907768204 1:57432083-57432105 TTGTTGCCCAGGATGGAGTGCGG - Intronic
908093984 1:60717858-60717880 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
908183274 1:61627054-61627076 CTCTTGGCCAAGATGGAGTCTGG - Intergenic
908187361 1:61665427-61665449 CTTTTGCCCAAGCTGGAGTGTGG + Intergenic
908244743 1:62218978-62219000 TTTTTTCTTGAGATAGAGTCTGG + Intergenic
908449072 1:64233017-64233039 TTTTTTTTCGAGATGGAGTCTGG + Intronic
908816707 1:68042637-68042659 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
909135874 1:71799722-71799744 TTTTTTTTTGAGATGGAGTCTGG + Intronic
909190272 1:72541529-72541551 TCCTTTCCCAAGATGCATTCTGG + Intergenic
909314856 1:74203398-74203420 TTTTTTTTTGAGATGGAGTCTGG + Intronic
909659337 1:78064778-78064800 TTGTTGCCCAAGCTGGAGTGTGG + Intronic
909783661 1:79582690-79582712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
909847299 1:80410981-80411003 TTTTTTAGCAAAATTGAGTCCGG + Intergenic
909905700 1:81191920-81191942 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
910007052 1:82410785-82410807 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
910257735 1:85265038-85265060 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
910454423 1:87381750-87381772 TTTTTTGGCAAGATGGACACAGG + Intergenic
910514716 1:88046973-88046995 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
910567963 1:88666724-88666746 TTTTTTCTTGAGACGGAGTCTGG - Intergenic
910574544 1:88745768-88745790 TTTTTGCTCAAGATGGTGTAGGG - Intronic
910836606 1:91519047-91519069 TTTTTTTTCGAGATGGGGTCTGG - Intronic
910886067 1:91964919-91964941 TTTTTTTTTGAGATGGAGTCTGG + Intronic
910959596 1:92747700-92747722 TTTTTTGGTGAGATGGAGTCTGG - Intronic
910967789 1:92824895-92824917 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911315387 1:96350458-96350480 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911419229 1:97618385-97618407 TTTTTTTTCTAGATGGAGTCTGG + Intronic
911597488 1:99813695-99813717 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911809215 1:102252650-102252672 TTTTTTCCCAAGACGGAATCTGG - Intergenic
911827053 1:102499758-102499780 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911868805 1:103064676-103064698 TTTTTTTTTGAGATGGAGTCTGG - Intronic
912031394 1:105249368-105249390 TTTCTTTCCTTGATGGAGTCTGG + Intergenic
912120982 1:106472317-106472339 TTTTTTCCCAAGATGGTGGTTGG + Intergenic
912133977 1:106636771-106636793 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
912171719 1:107108470-107108492 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
912352297 1:109025720-109025742 TCTTTTTCCGAGATGGAGTCTGG - Intronic
912815237 1:112823500-112823522 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
912834053 1:112979811-112979833 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
913196367 1:116459658-116459680 TTTTTTCTGGAGATGGAGTTTGG + Intergenic
913273872 1:117119594-117119616 TTTTTTTCTGAGATGGAGTCTGG - Intronic
913367262 1:118053731-118053753 TTTTTTCCCATTATGGTTTCAGG - Intronic
913480657 1:119286147-119286169 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
913970252 1:143409570-143409592 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914064627 1:144235166-144235188 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914097251 1:144554442-144554464 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914114523 1:144731188-144731210 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914301742 1:146383171-146383193 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914371171 1:147025572-147025594 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914689744 1:150015303-150015325 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914791921 1:150885878-150885900 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
914798384 1:150940984-150941006 TTTTTTTTTGAGATGGAGTCTGG - Intronic
914799245 1:150948280-150948302 TTTTTTTTTGAGATGGAGTCTGG + Intronic
914822433 1:151114998-151115020 TTTTTTCTTGAGACGGAGTCTGG - Intronic
914841540 1:151253156-151253178 TTTTTTTCAGAGATGGGGTCTGG + Intergenic
915059541 1:153169551-153169573 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
915254058 1:154612337-154612359 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915256158 1:154630999-154631021 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
915272721 1:154766689-154766711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915295673 1:154919868-154919890 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915398918 1:155608509-155608531 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915433576 1:155886142-155886164 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915485829 1:156219973-156219995 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915493083 1:156262462-156262484 TTTTTTTCTGAGATGGAGTCTGG - Intronic
915511908 1:156391199-156391221 GTCCTTCCCAAGATGGAGCCGGG - Intergenic
915566831 1:156719180-156719202 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915569157 1:156734541-156734563 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915582941 1:156826310-156826332 TTTTTTTCTGAGATGGAGTCTGG + Intronic
915602047 1:156928580-156928602 TTTTTTTGGGAGATGGAGTCTGG + Intronic
916048055 1:161015384-161015406 TTTTTTTTTGAGATGGAGTCTGG - Intronic
916406829 1:164506337-164506359 ATGTTTCCCAATATGGACTCGGG - Intergenic
916499997 1:165378446-165378468 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
916680899 1:167104105-167104127 TTTTTTTTCAAGACAGAGTCTGG - Intronic
916980239 1:170128289-170128311 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917125965 1:171687740-171687762 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917197840 1:172485203-172485225 TTGTTGCCCAAGCTGGAGTTTGG + Intergenic
917303641 1:173605141-173605163 TCTTTTCAGAAGATGGAGTTGGG - Intergenic
917330580 1:173876327-173876349 TTTTTTTTTTAGATGGAGTCTGG + Intronic
917436438 1:175025847-175025869 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917569465 1:176250325-176250347 TTCTTTCCCAAGATAGTGCCTGG + Intergenic
917796333 1:178535288-178535310 TTTTTTTTTGAGATGGAGTCTGG - Intronic
917868122 1:179217300-179217322 TTTTTTTTTGAGATGGAGTCTGG - Intronic
917875344 1:179281864-179281886 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
917927044 1:179798208-179798230 TTTTTTTTTGAGATGGAGTCTGG - Intronic
917983734 1:180293745-180293767 TTTTTTTTTAAGATGGAGTCAGG + Intronic
918650717 1:186959188-186959210 TTTTTTTTTGAGATGGAGTCTGG - Intronic
918806884 1:189059335-189059357 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
919140482 1:193565135-193565157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
919581519 1:199381042-199381064 TTCTTTTTTAAGATGGAGTCTGG + Intergenic
919636730 1:200010361-200010383 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
919697325 1:200591013-200591035 TTTTTTTTTGAGATGGAGTCTGG - Intronic
920060186 1:203222108-203222130 TTTTTTCCCATGAGGGCCTCGGG + Intronic
920125625 1:203691891-203691913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920149155 1:203890317-203890339 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
920520101 1:206617657-206617679 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
920629742 1:207640128-207640150 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920633787 1:207679006-207679028 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920717205 1:208351442-208351464 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
920742961 1:208598654-208598676 TTTTTGCAGCAGATGGAGTCAGG + Intergenic
921458010 1:215395117-215395139 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
922266834 1:223991975-223991997 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
922275914 1:224078247-224078269 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
922287942 1:224185366-224185388 TTGTTGCCCAAGCTGGAGTGCGG + Intronic
922340153 1:224648397-224648419 TTTTTTCCTGAGACAGAGTCTGG - Intronic
922457340 1:225785692-225785714 TTTTTTTTAAAGAAGGAGTCTGG + Intronic
922465104 1:225841292-225841314 TTTTTTCTCAAGACCCAGTCTGG + Intronic
922695821 1:227730433-227730455 TTTTTTGCCAATCTGGAGTGAGG + Intronic
922760723 1:228128745-228128767 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
922771476 1:228186247-228186269 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
922939195 1:229446720-229446742 TTTTTTTTTGAGATGGAGTCTGG - Intronic
922944658 1:229502545-229502567 TTTTTTTTTGAGATGGAGTCTGG - Intronic
923169731 1:231403754-231403776 TTTTTTTTTGAGATGGAGTCTGG - Intronic
923536914 1:234859504-234859526 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
923560244 1:235034496-235034518 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
923581967 1:235226531-235226553 TTTTTTTTTTAGATGGAGTCTGG + Intronic
923657784 1:235933155-235933177 TCTTTTTTCGAGATGGAGTCTGG - Intergenic
923676148 1:236082240-236082262 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
923702494 1:236313338-236313360 TTTTTTGGTGAGATGGAGTCTGG - Intergenic
924020021 1:239771074-239771096 TTTTTTTTTGAGATGGAGTCTGG - Intronic
924312313 1:242756875-242756897 TTGTTACCCAAGCTGGAGTGCGG - Intergenic
924327692 1:242912124-242912146 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
924605088 1:245527543-245527565 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1062886768 10:1022245-1022267 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1063512768 10:6662454-6662476 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1063736635 10:8763213-8763235 TCTTTTTCCAAGATGGAGATTGG - Intergenic
1063842075 10:10083308-10083330 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1064052508 10:12070498-12070520 TTTAATCCTAAAATGGAGTCTGG + Intronic
1064214221 10:13386115-13386137 TTTTTGCCCAGGCTGGAGTGTGG - Intergenic
1064265106 10:13819711-13819733 TTTTTTTCTGAGATGGGGTCTGG + Intronic
1064265629 10:13823042-13823064 TATTTTCCTAAGATGCAGTCTGG + Intronic
1064374505 10:14783475-14783497 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1064378109 10:14815266-14815288 TTTTTGTTCGAGATGGAGTCTGG - Intergenic
1064517584 10:16167789-16167811 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064648613 10:17485506-17485528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1064794878 10:19000242-19000264 TTGTTGCCCAAGCTGGAGTGTGG + Intergenic
1065048696 10:21767981-21768003 TTTTTTTTTAAGATGGAGTCTGG - Intronic
1065134783 10:22656784-22656806 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1065174737 10:23065350-23065372 TTTCTCCCCAAGATGGCATCTGG + Intergenic
1065179279 10:23108485-23108507 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1065200325 10:23306515-23306537 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1065291212 10:24231808-24231830 TTTTTTTTTGAGATGGAGTCCGG + Intronic
1065468173 10:26047761-26047783 TTTTTTATTGAGATGGAGTCTGG - Intronic
1065686379 10:28289287-28289309 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1065736752 10:28759944-28759966 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1065740797 10:28795371-28795393 TTTTTTTTTAAGCTGGAGTCAGG - Intergenic
1065895756 10:30162147-30162169 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1065908641 10:30282031-30282053 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066003131 10:31123138-31123160 TTTTTTCCCGAGATGGAGTCTGG - Intergenic
1066111702 10:32203208-32203230 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1066210935 10:33237589-33237611 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1066245048 10:33574571-33574593 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066259121 10:33711726-33711748 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066263501 10:33752288-33752310 TTTTTTTTTAAGATGGAGTTTGG - Intergenic
1066405753 10:35116331-35116353 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066506106 10:36046090-36046112 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1066697624 10:38092868-38092890 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1067151695 10:43740984-43741006 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1067323618 10:45245569-45245591 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1067420170 10:46138364-46138386 TTTCTCCCCAAAAAGGAGTCTGG + Intergenic
1067425850 10:46211156-46211178 TTTCTCCCCAAAAAGGAGTCTGG - Intergenic
1067486876 10:46658732-46658754 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1067505516 10:46844852-46844874 TTTCTCCCCAAAAAGGAGTCTGG + Intergenic
1067709158 10:48634994-48635016 TTTTTTCCCATTCTGGAGGCTGG - Intronic
1067994951 10:51261894-51261916 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1068025607 10:51639423-51639445 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068064335 10:52109749-52109771 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068334469 10:55614100-55614122 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068766146 10:60765842-60765864 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1069304481 10:66951693-66951715 TTTTTTCCCAAAAAGGAAACTGG + Intronic
1069321129 10:67172961-67172983 TTTTTTCCTGAGATGGGGTCTGG - Intronic
1069423476 10:68268742-68268764 TTTTTTCCCATGGTGGGGTAAGG - Intergenic
1069431142 10:68335481-68335503 TTTTTTCCCAAACTGGATTGGGG + Intronic
1069441012 10:68428019-68428041 TTTTTTTCTGAGATGGAGTTTGG - Intronic
1069479969 10:68772744-68772766 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1069512764 10:69054404-69054426 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1069687723 10:70329571-70329593 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1069697584 10:70398337-70398359 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1070038527 10:72751849-72751871 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1070061246 10:72984864-72984886 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1070066133 10:73036406-73036428 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1070119256 10:73559714-73559736 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1070309585 10:75263527-75263549 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1070507988 10:77132534-77132556 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1071144017 10:82545797-82545819 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1071313288 10:84364751-84364773 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1071611100 10:87031684-87031706 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1071853151 10:89595803-89595825 TTTTTTTTTAAGATGGAGTCCGG - Intronic
1072053604 10:91730959-91730981 TTTTTTCCAAAGGTTAAGTCAGG + Intergenic
1072087900 10:92098781-92098803 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1072096717 10:92188706-92188728 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG + Intronic
1072238814 10:93476262-93476284 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1072328256 10:94319879-94319901 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1072727758 10:97825082-97825104 TTTTTTCTCCAGATGGACTCTGG - Intergenic
1073329193 10:102659877-102659899 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1073372816 10:103006216-103006238 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1073404489 10:103285330-103285352 TTGTTGCCCAAGCTGGAGTGCGG + Intronic
1073620584 10:105043511-105043533 TATTTTCCCAAAATGTACTCTGG + Intronic
1073652172 10:105372781-105372803 TATTATTCCAAGATGGAGTTAGG + Intergenic
1074006859 10:109435236-109435258 TTTTTTTCTTAGATGGAGTCTGG + Intergenic
1074105224 10:110384270-110384292 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1074511330 10:114115162-114115184 TTTTTTGCAAGGATGGAGTGGGG - Intergenic
1074738969 10:116465521-116465543 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1074926314 10:118075940-118075962 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1074961312 10:118448465-118448487 TTGTTTGCCAAGAAGCAGTCAGG - Intergenic
1075129170 10:119724094-119724116 TTTTTTTCCAAGCTGCTGTCAGG + Intergenic
1075359575 10:121818243-121818265 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1075379021 10:122003665-122003687 TTCTTTTCTGAGATGGAGTCTGG + Intronic
1075721050 10:124587726-124587748 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1076045999 10:127294658-127294680 TTTTTTTTTAAGATGGAGTCTGG + Intronic
1076740550 10:132481061-132481083 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1076879717 10:133234269-133234291 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1077556665 11:3229234-3229256 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1077609064 11:3633045-3633067 GTTTCTTTCAAGATGGAGTCTGG + Intergenic
1078056544 11:8013942-8013964 TTTGTTCCTAAGATGGGGTGGGG - Intergenic
1078157763 11:8813521-8813543 TTCTTTCTCAGGATGGAGACTGG - Intronic
1078172394 11:8938259-8938281 TTATTTTTCGAGATGGAGTCTGG + Intergenic
1078373211 11:10769208-10769230 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1078782973 11:14457229-14457251 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1079229756 11:18639518-18639540 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1079339960 11:19603618-19603640 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1079470492 11:20773505-20773527 TTTTTTTTTAAGATGGAGTCTGG + Intronic
1079890796 11:26050274-26050296 TTTTTTCTAAAGACAGAGTCTGG - Intergenic
1080528397 11:33150005-33150027 TTTGTTTTCAAGACGGAGTCTGG - Intronic
1080601051 11:33820789-33820811 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1080736430 11:35020196-35020218 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1080755949 11:35198954-35198976 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1080980595 11:37399644-37399666 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1081369182 11:42277496-42277518 TTTTTTTTAGAGATGGAGTCTGG - Intergenic
1081397928 11:42609514-42609536 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1081424426 11:42909831-42909853 GTTTTTTCCAAGATTGAGCCTGG + Intergenic
1081619784 11:44612642-44612664 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1081636005 11:44722642-44722664 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1081995925 11:47364060-47364082 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1082062540 11:47872952-47872974 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1082098123 11:48147856-48147878 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1082638331 11:55624138-55624160 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1082679239 11:56148315-56148337 TTTTTTCCCAAGAAAGAGAAAGG + Intergenic
1082694722 11:56347652-56347674 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1082805624 11:57447766-57447788 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1082904794 11:58294544-58294566 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083028508 11:59570868-59570890 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083058954 11:59849700-59849722 TGTTTTTCTGAGATGGAGTCTGG + Intergenic
1083286368 11:61661712-61661734 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1083288766 11:61678395-61678417 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1083336061 11:61922509-61922531 TTTTTTTCCAAGACGGAGTTTGG - Intergenic
1083422795 11:62564745-62564767 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1083760906 11:64817018-64817040 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1083786560 11:64952215-64952237 TTCTTGCCCAGGCTGGAGTCTGG + Intronic
1083929211 11:65830371-65830393 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1083960940 11:66014557-66014579 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083976794 11:66128870-66128892 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1084056560 11:66637871-66637893 TTTTTTCTCAGGGTGGGGTCGGG + Intronic
1084203788 11:67579068-67579090 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1084217383 11:67656616-67656638 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1084281270 11:68096026-68096048 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1084283000 11:68111399-68111421 TTTTTTCTTGAGATGGAGTTTGG - Intronic
1084347912 11:68568779-68568801 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1084874376 11:72119997-72120019 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1084989204 11:72907614-72907636 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1085285075 11:75354290-75354312 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1085287500 11:75373444-75373466 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1085421618 11:76366667-76366689 TTTTTTTCCGAGACGGAGTCTGG - Intronic
1085814230 11:79718826-79718848 TTTTTTTCTGAGGTGGAGTCTGG - Intergenic
1086000166 11:81974289-81974311 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1086237773 11:84652941-84652963 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1086336533 11:85806750-85806772 TGGTTTCCCAAGTTGAAGTCTGG - Intronic
1086582671 11:88417077-88417099 TTTTTTTTCCAGGTGGAGTCTGG - Intergenic
1086748582 11:90461871-90461893 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1086884520 11:92189886-92189908 TTTTTGGTCAAGGTGGAGTCTGG + Intergenic
1086884857 11:92193745-92193767 TTTTTTTCTCAGACGGAGTCTGG + Intergenic
1086885066 11:92196216-92196238 TTTTTTTCTCAGACGGAGTCTGG - Intergenic
1087145820 11:94810619-94810641 TTTCTCCCCAAAAGGGAGTCTGG + Intronic
1087439521 11:98164752-98164774 TTTTTTTTTAAGACGGAGTCTGG + Intergenic
1087445284 11:98243182-98243204 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1087581442 11:100060648-100060670 TTTTTTTTTAAGATGGAGTTTGG + Intronic
1087670828 11:101104821-101104843 ATTTTTCCTAAGATAGAATCTGG + Intronic
1087787950 11:102375766-102375788 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1087850580 11:103023690-103023712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1088017096 11:105074198-105074220 TTTCTTCCCCAGATAGAGCCAGG + Intronic
1088225134 11:107611691-107611713 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1088460192 11:110074826-110074848 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1088867902 11:113866278-113866300 TTTTTCCCCAAGACAGAGTCTGG - Intronic
1089249907 11:117151239-117151261 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1089520835 11:119062098-119062120 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1089550826 11:119275848-119275870 TCTTTTTTTAAGATGGAGTCTGG - Intronic
1089576764 11:119450051-119450073 TTTTTTCTCATGAAGCAGTCTGG + Intergenic
1089658996 11:119973713-119973735 TTTTTGCCCAGGCTGGAGTCTGG - Intergenic
1089743871 11:120603615-120603637 TTTATTTTCAAGATGGGGTCAGG - Intronic
1089767418 11:120777923-120777945 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1090005834 11:123001602-123001624 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1090094121 11:123726875-123726897 CTATTTCCCAATCTGGAGTCTGG + Exonic
1090153983 11:124417296-124417318 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1090386780 11:126361891-126361913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1090431664 11:126651509-126651531 TTTATTCCCAAGATCCAGTTAGG - Intronic
1090481121 11:127069459-127069481 TTTTTTTTCGAGATGGATTCTGG - Intergenic
1090815253 11:130288360-130288382 TTTTTTCCCGAGACAGAGTCTGG - Intronic
1091074420 11:132601790-132601812 ATTTTTCTCCAAATGGAGTCAGG + Intronic
1091275497 11:134346711-134346733 TTGGTTCCAAAGCTGGAGTCAGG - Intronic
1091466434 12:688822-688844 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1091470330 12:720836-720858 TTTTTTTTTGAGATGGAGTCCGG + Intergenic
1092226420 12:6751227-6751249 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092251593 12:6901460-6901482 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1092391612 12:8085029-8085051 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092736750 12:11589834-11589856 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1092808317 12:12248491-12248513 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092898080 12:13032843-13032865 TGTTTTCCCATGCTGGAGTGTGG - Intergenic
1092933110 12:13336030-13336052 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1093029832 12:14277991-14278013 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093034372 12:14319535-14319557 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093546228 12:20352471-20352493 CTTTTTTTCGAGATGGAGTCTGG + Intergenic
1093585260 12:20828403-20828425 TTTCTCCCCAAAAAGGAGTCTGG + Intronic
1093596540 12:20969044-20969066 GTTTCTCCCAAAAAGGAGTCTGG + Intergenic
1093804066 12:23410482-23410504 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093966486 12:25332174-25332196 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1094109296 12:26844181-26844203 TTTTTTTTTAAGATGGGGTCTGG - Intergenic
1094209971 12:27878528-27878550 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
1094581327 12:31736472-31736494 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
1094673921 12:32599557-32599579 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1095212057 12:39506039-39506061 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1095324531 12:40872582-40872604 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1095445100 12:42274845-42274867 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1096228480 12:49884210-49884232 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1096290951 12:50342947-50342969 TTTTTTTTAAAGATGGAGTCAGG + Intronic
1096336860 12:50763602-50763624 TTTTTTTCCGAGATTGAGACGGG - Intergenic
1096719341 12:53509513-53509535 TTTTTTTTTACGATGGAGTCTGG + Intronic
1096726963 12:53572053-53572075 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1096852571 12:54450764-54450786 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1097010338 12:55949008-55949030 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1097033852 12:56109111-56109133 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1097238627 12:57557713-57557735 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1097381286 12:58898669-58898691 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1097575887 12:61391700-61391722 CTCTTTCCCAGGCTGGAGTCTGG - Intergenic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1098057932 12:66528144-66528166 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1098862569 12:75726573-75726595 TTTTTTTTAAATATGGAGTCTGG + Intergenic
1099090190 12:78297272-78297294 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1099121293 12:78692420-78692442 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1099187557 12:79532640-79532662 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1099517619 12:83617197-83617219 GTTTTTCCCAAGCTATAGTCTGG + Intergenic
1099696504 12:86028494-86028516 TTTTTTCCCCAGATAAACTCTGG + Intronic
1099767881 12:87012661-87012683 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1099867087 12:88296300-88296322 TTTTTTTTCGAGATGGAGTTTGG - Intergenic
1099873832 12:88380983-88381005 TTATTACCCAAGCTGGAGTATGG + Intergenic
1099905660 12:88766598-88766620 TTTTTTCCAAAGATGTTTTCAGG - Intergenic
1100101186 12:91107725-91107747 TTTTTTTCCAAGACAGAATCTGG + Intronic
1100129331 12:91471267-91471289 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1100258489 12:92908833-92908855 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1100264189 12:92959997-92960019 TTTTTTCCTGAGACTGAGTCTGG - Intergenic
1100281379 12:93121265-93121287 TTTTTTTGTGAGATGGAGTCTGG - Intergenic
1100297101 12:93273463-93273485 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1100371242 12:93970815-93970837 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1100639994 12:96473216-96473238 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1100765611 12:97862426-97862448 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1100817247 12:98398100-98398122 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1100881153 12:99017969-99017991 TTTTTTCCAAAGAGGGTCTCAGG - Intronic
1101110264 12:101479826-101479848 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1101148356 12:101862955-101862977 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1101216230 12:102586912-102586934 TTTTTTTTTAAGATAGAGTCTGG - Intergenic
1101341529 12:103846110-103846132 TTATTTTTTAAGATGGAGTCTGG - Intergenic
1101369445 12:104112900-104112922 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1101507380 12:105359757-105359779 TTTTTTCTGGAGAAGGAGTCTGG - Intronic
1101917968 12:108911020-108911042 TTTTTTCCCATGGTGAAGGCAGG - Exonic
1101935200 12:109051579-109051601 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1102180519 12:110909249-110909271 TTTTTTTCCGAGACGGAGTTTGG + Intergenic
1102191220 12:110989985-110990007 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1102438684 12:112945298-112945320 TTTTTCCTTGAGATGGAGTCTGG - Intronic
1102475987 12:113188820-113188842 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1102503337 12:113368066-113368088 TTTTTTCCTGAGACAGAGTCTGG - Intronic
1102509764 12:113406639-113406661 TTTCTCCCCAAAAAGGAGTCTGG - Intronic
1102728395 12:115086610-115086632 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1103118211 12:118356309-118356331 TTTTTTTTTGAGATGGAGTCCGG + Intronic
1103208239 12:119146922-119146944 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1103297080 12:119896864-119896886 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1103502413 12:121413446-121413468 CTTTTGCCCAAGCTGGAGTGCGG + Intronic
1103530560 12:121598240-121598262 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1103584698 12:121943450-121943472 TTGTTGCCCAGGCTGGAGTCTGG + Intronic
1103646501 12:122397539-122397561 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1103678313 12:122674026-122674048 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1103690844 12:122773467-122773489 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1103767032 12:123287629-123287651 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1103804428 12:123561280-123561302 TTGTTTCCCAAGATGGGTTTTGG - Intergenic
1103816010 12:123657065-123657087 TTTTTTCTTAAGAGGGAGACAGG - Intronic
1104223160 12:126805825-126805847 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1104449181 12:128855211-128855233 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1104730235 12:131101396-131101418 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1104737489 12:131145901-131145923 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1104773592 12:131379792-131379814 GTGTTTCCCGAGATGCAGTCTGG - Intergenic
1105237991 13:18579242-18579264 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105382580 13:19901506-19901528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105596539 13:21844571-21844593 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1105696608 13:22895654-22895676 TTTTGCCCCCAGAAGGAGTCTGG - Intergenic
1105731288 13:23219755-23219777 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1105887692 13:24656033-24656055 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1105909736 13:24852148-24852170 TTTTTTTCTGAGACGGAGTCTGG + Intronic
1105970692 13:25426932-25426954 TTATTTTCCTAGAGGGAGTCTGG - Intronic
1106018477 13:25891996-25892018 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1106034849 13:26034519-26034541 TTTTTGCCCAGGCTGGAGTGTGG + Intergenic
1106084040 13:26524347-26524369 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106129118 13:26925014-26925036 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106232440 13:27831315-27831337 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106263087 13:28085330-28085352 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106644401 13:31616971-31616993 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106666206 13:31853112-31853134 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106685183 13:32051162-32051184 TTTTATCCCAGGATGTAGTTGGG + Intronic
1106812780 13:33376607-33376629 TTTTTTTTAAAGATGGGGTCTGG - Intergenic
1107120714 13:36792425-36792447 TTTTTGCCCAGGCTGGAGTGCGG - Intergenic
1107429103 13:40322961-40322983 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1108213020 13:48157277-48157299 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1108384545 13:49886838-49886860 TTTTTTTCTGAGATGGAGTATGG - Intergenic
1108394988 13:49983190-49983212 ATTTTTTCTGAGATGGAGTCCGG - Intergenic
1108613438 13:52106753-52106775 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1109021260 13:57095296-57095318 TTTTTTTTTAAGATGGAGTTTGG - Intergenic
1109253834 13:60052946-60052968 TTTTTTTTTAAGAGGGAGTCTGG - Intronic
1109785175 13:67164560-67164582 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1110117363 13:71836156-71836178 TTTTTTCTCAAGATGGTGAAAGG - Intronic
1110769946 13:79331020-79331042 TTTTTTGCTAAGATAGGGTCTGG + Intronic
1110775026 13:79397667-79397689 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1110844404 13:80177835-80177857 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1111048909 13:82852807-82852829 TTTTTTGCCATCATGGAGTGGGG + Intergenic
1111232389 13:85361024-85361046 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1111263235 13:85771773-85771795 TTTTTTCCTAAGAGGCAGTCTGG - Intergenic
1111740366 13:92197532-92197554 TTTTCTCCCAGGATGGAGTGTGG + Intronic
1112106111 13:96241795-96241817 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1112202718 13:97292187-97292209 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1112282004 13:98071046-98071068 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1112372552 13:98806895-98806917 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1112912446 13:104504032-104504054 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1112968899 13:105234415-105234437 TTTTTTACGAAGTAGGAGTCAGG + Intergenic
1113035448 13:106042710-106042732 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1113115287 13:106868675-106868697 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1113692233 13:112319124-112319146 CTTTTTTTCAGGATGGAGTCCGG + Intergenic
1113918915 13:113894605-113894627 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1114057922 14:18990893-18990915 TTTTTTTTTAAGATGAAGTCTGG + Intronic
1114104625 14:19410860-19410882 TTTTTTTTTAAGATGAAGTCTGG - Intronic
1114197795 14:20494351-20494373 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1114354159 14:21889210-21889232 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1114509862 14:23249506-23249528 TTTTTACACAAGCTGGAGTATGG - Intronic
1114550128 14:23527916-23527938 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1114663344 14:24364163-24364185 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1115455353 14:33595680-33595702 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1115509709 14:34127576-34127598 TTTTTTGGTGAGATGGAGTCTGG - Intronic
1115791110 14:36879650-36879672 TTTTTTCCCAATATTGGCTCAGG - Intronic
1115867029 14:37759249-37759271 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1116175585 14:41466231-41466253 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1116607060 14:47013824-47013846 TTTTTGCCCAGGCTGGAGTATGG + Intronic
1116943132 14:50810671-50810693 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1117011102 14:51471487-51471509 TTTTTTTTCGAGACGGAGTCTGG - Intergenic
1117132620 14:52701437-52701459 TTTTAACCCATGATGCAGTCTGG + Intergenic
1117151462 14:52892489-52892511 TTCTTGCCCAAGTTGGAGTGTGG + Intronic
1117307804 14:54493436-54493458 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1117444262 14:55788605-55788627 TTTTTTTTTAAGACGGAGTCTGG + Intergenic
1117681001 14:58202570-58202592 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1118133715 14:62997886-62997908 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1118189173 14:63564989-63565011 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1118211175 14:63767116-63767138 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1118377662 14:65191125-65191147 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1118405911 14:65423271-65423293 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1118878405 14:69804668-69804690 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1119255730 14:73194578-73194600 TTTTTTTTCAAGACGGAGTCTGG + Intronic
1119283496 14:73430931-73430953 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1119283765 14:73433408-73433430 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1119382114 14:74235911-74235933 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1119678687 14:76575639-76575661 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1119815978 14:77567836-77567858 TTTTTTTTTAAGATGGAGTCTGG + Intronic
1119994857 14:79242053-79242075 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1120346985 14:83302799-83302821 TTTTTTTCCAAGACAGAGTTTGG - Intergenic
1120422446 14:84304800-84304822 TATTTTTTTAAGATGGAGTCTGG - Intergenic
1120441619 14:84548148-84548170 TTTTTCCCCAATCTGGAGGCAGG - Intergenic
1120589225 14:86355729-86355751 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1120810336 14:88796109-88796131 TTGTTTCCCAGGCTGGAGTGCGG - Intergenic
1120828342 14:88975222-88975244 TTTTGGCCCAAGCTGGAGTTTGG - Intergenic
1120913551 14:89689673-89689695 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1121010117 14:90515086-90515108 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1121045456 14:90784543-90784565 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1121126710 14:91412445-91412467 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1121172178 14:91863813-91863835 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1121390501 14:93569423-93569445 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1121475966 14:94202968-94202990 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1121606234 14:95242268-95242290 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1122427183 14:101617833-101617855 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1122457113 14:101863004-101863026 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122464769 14:101924449-101924471 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1122563590 14:102635009-102635031 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122673362 14:103389350-103389372 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1123416444 15:20099124-20099146 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123436259 15:20256843-20256865 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1123525782 15:21106229-21106251 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123703947 15:22937608-22937630 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1123786243 15:23677422-23677444 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1123844397 15:24283132-24283154 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1123863827 15:24496768-24496790 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1124816619 15:33000435-33000457 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1125005148 15:34808235-34808257 CTTTTTGCCAGGATGGTGTCAGG + Intergenic
1125467543 15:39969370-39969392 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125563753 15:40659502-40659524 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125595087 15:40879915-40879937 TTTTTTTTTAAGATAGAGTCTGG + Intergenic
1125677379 15:41509846-41509868 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1125806004 15:42494404-42494426 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125811066 15:42541769-42541791 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1125840215 15:42793538-42793560 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1125869040 15:43080937-43080959 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1125961449 15:43833328-43833350 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1126076649 15:44917749-44917771 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1126114409 15:45196107-45196129 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1126470497 15:49005316-49005338 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1126785638 15:52176035-52176057 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1126892688 15:53223068-53223090 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1126917775 15:53484609-53484631 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1127184793 15:56466906-56466928 TTTTTTTCTGAGATGAAGTCTGG + Intergenic
1127644197 15:60943902-60943924 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1127914655 15:63445498-63445520 TTTGATCCCAAGATGCAGCCTGG + Intergenic
1127947278 15:63767659-63767681 TTGTTTCCCAGGCTGGAGTGCGG - Intronic
1128000378 15:64185848-64185870 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1128046856 15:64625875-64625897 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1128083599 15:64871232-64871254 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1128129651 15:65217585-65217607 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1128215241 15:65930159-65930181 TTTCTGCCCAGGGTGGAGTCTGG + Intronic
1128269529 15:66296526-66296548 TTTTTCCTTGAGATGGAGTCTGG + Intronic
1128641399 15:69340627-69340649 TTTCTTCCCATGGTGGATTCAGG + Intronic
1128693066 15:69739917-69739939 TTCTTTGCCAAGCTGGAGTTTGG + Intergenic
1128750919 15:70148439-70148461 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1128956109 15:71947267-71947289 TTTTTTCCTGAGATGGAGTCTGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129378044 15:75146323-75146345 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1129586545 15:76873237-76873259 CTTTTTCGGGAGATGGAGTCTGG - Intronic
1129763259 15:78144344-78144366 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1129837157 15:78716333-78716355 TTTTTTTCAAATATAGAGTCAGG - Intronic
1129942997 15:79514527-79514549 TTTCTTCCCATAATGGAATCAGG - Intergenic
1130000777 15:80044883-80044905 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1130170868 15:81512334-81512356 TTTGTTTTTAAGATGGAGTCTGG + Intergenic
1130397620 15:83517214-83517236 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1130608452 15:85338750-85338772 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1130726519 15:86444818-86444840 CTTTTTCCCAAGATGGAATGTGG - Intronic
1130727827 15:86459382-86459404 TTTGTCCCCAAGATTGAGACTGG + Intronic
1131360226 15:91784194-91784216 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131489555 15:92850818-92850840 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1131516842 15:93084482-93084504 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1131619394 15:94051108-94051130 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1132069372 15:98762247-98762269 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1132094111 15:98969424-98969446 TCTTTTCCCGAGATGCAGGCAGG - Exonic
1132258373 15:100399112-100399134 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1132322200 15:100933808-100933830 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1132817986 16:1843684-1843706 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1132952783 16:2573829-2573851 TTGTTGCCCAAGCTGGAGTGCGG + Intronic
1132961568 16:2626339-2626361 TTGTTGCCCAAGCTGGAGTGCGG - Intergenic
1133047297 16:3095814-3095836 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1133059038 16:3162377-3162399 GTTTTTTCTGAGATGGAGTCTGG + Intergenic
1133179604 16:4043371-4043393 TTTTTTCACAATGTGGAGTCTGG + Intronic
1133580365 16:7138818-7138840 TTTTTTTATAAGATGGAGTCTGG + Intronic
1133815892 16:9197162-9197184 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1134101789 16:11457578-11457600 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1134154375 16:11830816-11830838 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1134174259 16:11993126-11993148 TTGTTGCCCAAGCTGGAGTACGG - Intronic
1134218738 16:12336907-12336929 TTGTTGCCCAAGCTGGAGTATGG - Intronic
1134230273 16:12423580-12423602 CTTCTTCTCGAGATGGAGTCTGG + Intronic
1134415532 16:14040472-14040494 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1134593083 16:15473158-15473180 TTTTTTTTAAAGATGGAATCTGG - Intronic
1134642318 16:15838843-15838865 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1134785480 16:16938492-16938514 TTTTTTCCCAAGTTTGAGATAGG - Intergenic
1135019822 16:18954203-18954225 TTTTTTCCCCCGAGAGAGTCTGG + Intergenic
1135318568 16:21473518-21473540 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1135346824 16:21695904-21695926 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1135371461 16:21905314-21905336 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1135411740 16:22240088-22240110 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1135440326 16:22465401-22465423 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1135662101 16:24305871-24305893 TTGTTACCCAAGGTGGGGTCTGG + Intronic
1135730210 16:24888806-24888828 TTTTTTTCTGAGACGGAGTCTGG + Intronic
1136219488 16:28819408-28819430 TTTTTTTATGAGATGGAGTCTGG + Intergenic
1136319694 16:29475874-29475896 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136396993 16:29998277-29998299 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1136434265 16:30215219-30215241 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136504489 16:30694233-30694255 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136557635 16:31017328-31017350 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136635033 16:31515340-31515362 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1136798039 16:33041888-33041910 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1137422658 16:48349280-48349302 TTTTCTATCGAGATGGAGTCCGG + Intronic
1137630685 16:49941662-49941684 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1137728742 16:50674423-50674445 TTTTTTTAAAAGATGGGGTCTGG + Intronic
1137827485 16:51511890-51511912 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1137989987 16:53144538-53144560 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1138049410 16:53760636-53760658 TTTTTTCCTGAGACTGAGTCTGG + Intronic
1138058019 16:53856736-53856758 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1138497723 16:57418343-57418365 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1138592312 16:58007944-58007966 CTTTTGCCCAGGATGGAGTACGG - Intronic
1138604211 16:58077427-58077449 TTGTTTCCCAGGCTGGAGTGTGG - Intergenic
1138632466 16:58309396-58309418 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1138978337 16:62236524-62236546 TTTTTTACCAAGAAAGAGTAGGG + Intergenic
1139165229 16:64558038-64558060 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1139241448 16:65396504-65396526 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1139372521 16:66477770-66477792 CTCTTTCCCATGATGGAGTTGGG - Intronic
1139408475 16:66738975-66738997 TTTTTATCCAAAATGGAGTATGG - Intronic
1139578869 16:67859989-67860011 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1139768783 16:69255546-69255568 TTTTTTTTTAAGACGGAGTCTGG - Intronic
1139808133 16:69587398-69587420 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1139825413 16:69753208-69753230 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1139836871 16:69846036-69846058 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1139890164 16:70247220-70247242 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1140286023 16:73603783-73603805 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140341633 16:74170580-74170602 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140472056 16:75221369-75221391 TTTTTTCTTGAGATGGAGTTTGG + Intronic
1140506460 16:75476547-75476569 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1140529498 16:75651675-75651697 TTTCTTTCCGAGATGGAGTCTGG - Intronic
1140690321 16:77477549-77477571 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140727438 16:77826009-77826031 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141066862 16:80920935-80920957 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1141084188 16:81079720-81079742 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1141088601 16:81114506-81114528 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
1141179174 16:81740711-81740733 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141297374 16:82782538-82782560 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141300334 16:82809707-82809729 TTTGTTCCCAAGAGGGAATTTGG + Intronic
1141454327 16:84129366-84129388 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141457464 16:84152943-84152965 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1141543741 16:84748140-84748162 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141959841 16:87398032-87398054 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1142068416 16:88075756-88075778 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1142369972 16:89673869-89673891 TTTCTCCCCAAAAAGGAGTCTGG - Intergenic
1142391012 16:89799980-89800002 CTTTTTTCCGAGACGGAGTCTGG - Intronic
1142545426 17:698419-698441 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1142770635 17:2094259-2094281 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1142791421 17:2269206-2269228 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1142949857 17:3470080-3470102 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1143115164 17:4577843-4577865 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1143464360 17:7125992-7126014 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1143581972 17:7833060-7833082 TTTCTCCCCAGGATGGTGTCTGG + Exonic
1143638868 17:8183889-8183911 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1143943081 17:10563663-10563685 TTTTTTTCTGAGATGCAGTCTGG + Intergenic
1144043516 17:11433909-11433931 TAATTTCCCAAGATGAAATCAGG + Intronic
1144266922 17:13578549-13578571 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1144267019 17:13579687-13579709 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1144267977 17:13589760-13589782 TTTTTTCAAAACATGGAGTTAGG + Intronic
1144298589 17:13902097-13902119 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1144344368 17:14336720-14336742 CTTTTTCCCAATATTGAGGCAGG - Intronic
1144861875 17:18309719-18309741 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1145066413 17:19764400-19764422 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
1145071272 17:19810216-19810238 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1145184656 17:20784056-20784078 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
1145286380 17:21509069-21509091 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1145300288 17:21629982-21630004 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1145359347 17:22199293-22199315 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1145767380 17:27468245-27468267 TTTTTTTCTGAGATGGAGCCTGG + Intronic
1146080639 17:29777206-29777228 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1146216820 17:30983363-30983385 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1146369932 17:32259409-32259431 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1146682701 17:34819788-34819810 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1146729540 17:35182099-35182121 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1146784078 17:35703251-35703273 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1146808514 17:35884814-35884836 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1146874597 17:36398563-36398585 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1147064786 17:37914318-37914340 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1147221901 17:38939279-38939301 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1147271827 17:39278557-39278579 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1147353933 17:39875906-39875928 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1147404438 17:40200773-40200795 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1147695218 17:42347171-42347193 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1147719188 17:42527929-42527951 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1148011153 17:44482560-44482582 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1148294854 17:46492703-46492725 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1148411727 17:47473016-47473038 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1148500863 17:48089930-48089952 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1148634893 17:49141426-49141448 TCTTTTCCTACGATGGAATCTGG + Exonic
1148696651 17:49564031-49564053 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
1148924870 17:51075182-51075204 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1149076492 17:52601639-52601661 TTTTTCCACAAGATGGGGTGGGG + Intergenic
1149196232 17:54125481-54125503 TTTTTTTAGACGATGGAGTCTGG + Intergenic
1149308215 17:55369599-55369621 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1149328551 17:55558061-55558083 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1149385750 17:56141940-56141962 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1149874133 17:60213952-60213974 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1150087915 17:62291212-62291234 TTTTTTTTAAAGATGGAGTCTGG + Intergenic
1150114827 17:62538045-62538067 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1150389623 17:64782735-64782757 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1150407751 17:64917232-64917254 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1150490450 17:65570587-65570609 TTTATTCATTAGATGGAGTCTGG - Intronic
1150492074 17:65581238-65581260 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1150746258 17:67819266-67819288 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1151001074 17:70377325-70377347 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1151519984 17:74621029-74621051 TTTTTTTTCGAGAGGGAGTCTGG - Intronic
1151561165 17:74870503-74870525 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151605712 17:75134119-75134141 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1151607171 17:75145150-75145172 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151642956 17:75409746-75409768 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1151689189 17:75670308-75670330 TTTTTTTTTAAGATGGAGTCTGG - Intronic
1151753067 17:76052790-76052812 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151824601 17:76517127-76517149 TTTTTTCCTGAGACAGAGTCTGG - Intergenic
1151844139 17:76639561-76639583 TTATTTTTCGAGATGGAGTCTGG - Intronic
1151864418 17:76790927-76790949 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1152540046 17:80970264-80970286 TTCTTTCCCAAGGTGGAGGAGGG - Intergenic
1152773740 17:82187223-82187245 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1153331751 18:3880929-3880951 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1154009396 18:10562196-10562218 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
1154076696 18:11210090-11210112 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1154132447 18:11749112-11749134 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1154136919 18:11787860-11787882 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1154253173 18:12761114-12761136 TTTTTTTCCGAGACGGAGTCTGG - Intergenic
1154964081 18:21339173-21339195 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1154965164 18:21348761-21348783 TTTTTCTTCGAGATGGAGTCTGG - Intronic
1155199902 18:23508162-23508184 TTGATTCCCAAACTGGAGTCAGG + Intronic
1155441226 18:25864785-25864807 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1155962593 18:32007275-32007297 TGTTTTTTTAAGATGGAGTCTGG + Intergenic
1155973233 18:32101224-32101246 TTTTTTTCAAAGACAGAGTCTGG + Intronic
1155990566 18:32275075-32275097 TTTTTCCCCTAGATTGACTCAGG - Intronic
1156241493 18:35258856-35258878 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1157263715 18:46198296-46198318 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1157352101 18:46897906-46897928 TTATTGCCCAAGCTGGAGTGTGG + Intronic
1157377068 18:47176579-47176601 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1158280079 18:55814714-55814736 TTTTTTCCCAAAAAAGAGTTTGG - Intergenic
1158626229 18:59073677-59073699 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1158990941 18:62867821-62867843 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1159270305 18:66140720-66140742 TTGTTTCCCAGGCTGGAGTGTGG + Intergenic
1159456626 18:68667704-68667726 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1159737135 18:72114146-72114168 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1159867452 18:73723032-73723054 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1159956831 18:74524592-74524614 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1160359964 18:78266828-78266850 TTTTATCCCAACCTGGAGGCTGG - Intergenic
1160368305 18:78348808-78348830 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1160913464 19:1485857-1485879 TTGTTTTTGAAGATGGAGTCTGG - Intronic
1161126228 19:2559524-2559546 TTTTCTCTCAAGATGGAGTTTGG + Intronic
1161182500 19:2893708-2893730 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1161203853 19:3029972-3029994 TTTTTTGCAGAGATGGAGTAGGG + Intronic
1161239762 19:3215776-3215798 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
1161259330 19:3327973-3327995 TTTGTTTTTAAGATGGAGTCTGG + Intergenic
1161421820 19:4180114-4180136 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1161424298 19:4194172-4194194 TTTTGTTCCGAGATGGAGTCTGG + Intronic
1161535165 19:4814670-4814692 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1161674525 19:5637330-5637352 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1161692920 19:5747622-5747644 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1161737416 19:5999993-6000015 TTTTTTCTTGAGATGGAGTTTGG + Intronic
1161831915 19:6612333-6612355 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1161903654 19:7138552-7138574 TTTTTTGCAGAGATGGGGTCTGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162088817 19:8264546-8264568 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162449159 19:10744144-10744166 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1162468939 19:10860521-10860543 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162513434 19:11133875-11133897 TTTTTTCCTGAGATGGAGCCTGG + Intronic
1162661515 19:12172997-12173019 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162702011 19:12523420-12523442 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1162752080 19:12835044-12835066 TCTTTTCCCAAGATTCAGGCTGG - Intronic
1163318014 19:16554806-16554828 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1163339497 19:16695954-16695976 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1163359850 19:16839008-16839030 TTGTTTCCCAGGCTGGAGTGCGG + Intronic
1163412494 19:17164390-17164412 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1163451496 19:17379936-17379958 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1163626881 19:18395357-18395379 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163675248 19:18652576-18652598 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163688795 19:18727067-18727089 TTTTTTGCTGAGATGGGGTCTGG - Intronic
1163779209 19:19237475-19237497 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163809639 19:19422721-19422743 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1163956616 19:20648386-20648408 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1163983646 19:20924790-20924812 TTTTTTTACAATATGGTGTCAGG - Intronic
1163993875 19:21024766-21024788 TTTTTTTTTAAGATGGAATCTGG - Intronic
1164045721 19:21538264-21538286 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1164070611 19:21764626-21764648 TTTTTTCCCCACACGGAGTCTGG - Intronic
1164281082 19:23769353-23769375 TCTTTTTTCGAGATGGAGTCTGG + Intronic
1164553445 19:29231917-29231939 TTTTTTGTAGAGATGGAGTCTGG - Intergenic
1164647001 19:29865874-29865896 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1164774247 19:30839444-30839466 TCTCTTCCCAGGATGGAGTGTGG - Intergenic
1164783410 19:30911479-30911501 TTTTTTCCAAAAATGTGGTCTGG + Intergenic
1164965783 19:32481591-32481613 TTTTTTGTAAAGATGGAGTCTGG + Intronic
1165021148 19:32925499-32925521 TTTTTTTTCGAGACGGAGTCTGG + Intronic
1165036259 19:33036103-33036125 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165178011 19:33944232-33944254 TTTTTTTTGTAGATGGAGTCCGG + Intergenic
1165340506 19:35208473-35208495 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1165568264 19:36751685-36751707 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165583284 19:36888702-36888724 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1165651970 19:37499269-37499291 TCTTTTTCTAAGATGGAGTTAGG - Intergenic
1165691318 19:37865942-37865964 TTGTTTCCCAGGCTGGAGTACGG + Intergenic
1165739075 19:38195037-38195059 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165744268 19:38221526-38221548 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165785110 19:38457032-38457054 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1166089777 19:40501225-40501247 TTTTTTCAAGAGATGGAGTCTGG - Intronic
1166217042 19:41342524-41342546 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166248357 19:41546952-41546974 TTTTTTTAAATGATGGAGTCTGG - Intergenic
1166396772 19:42446903-42446925 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1166520571 19:43477503-43477525 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1166629315 19:44391139-44391161 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1166635831 19:44451284-44451306 TTGTTGCCCAAGCTGGAGTGCGG - Intergenic
1166715857 19:44967139-44967161 TTTTTTACAGAGATGGGGTCAGG - Intronic
1166728503 19:45043891-45043913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166859736 19:45802828-45802850 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166922702 19:46241255-46241277 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1166964957 19:46523874-46523896 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1167076316 19:47251834-47251856 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
1167130038 19:47579097-47579119 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1167244782 19:48366376-48366398 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1167290608 19:48623226-48623248 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1167353082 19:48987810-48987832 TTTTTTCTTGAGACGGAGTCTGG + Intronic
1167441007 19:49508857-49508879 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1168040558 19:53755369-53755391 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168041465 19:53762621-53762643 TTCTTTCTCAAGAGAGAGTCTGG + Intergenic
1168044593 19:53785398-53785420 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168048571 19:53811500-53811522 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1168068160 19:53931771-53931793 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1168084919 19:54038551-54038573 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168096408 19:54117838-54117860 TATTTTTTAAAGATGGAGTCTGG - Intronic
1168142861 19:54400927-54400949 TTTTTTAAAGAGATGGAGTCTGG - Intergenic
1168483086 19:56737802-56737824 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
1168699092 19:58425242-58425264 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
925252894 2:2456086-2456108 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
925838177 2:7965785-7965807 TTTTTTCCTGAGAAGGAGTCTGG - Intergenic
926043300 2:9691807-9691829 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926286111 2:11489445-11489467 TTTTCCCCCAAGACGGAGTCTGG - Intergenic
926397752 2:12462253-12462275 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926525343 2:13973436-13973458 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926751156 2:16199612-16199634 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
926762998 2:16296028-16296050 TTTTTTCCAAAGGTGCAGTGTGG - Intergenic
927346458 2:22049060-22049082 TTTTTTCCCAAGTTAGAAACAGG - Intergenic
927458841 2:23280120-23280142 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
927601413 2:24445358-24445380 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
927648071 2:24892258-24892280 TTTTTTTTTGAGATGGAGTCTGG + Intronic
927750699 2:25667481-25667503 TTTTTTTTTGAGATGGAGTCTGG - Intronic
927905817 2:26855415-26855437 TTTTTTTTTGAGATGGAGTCTGG - Intronic
928176986 2:29041034-29041056 TTTTTTTTTGAGATGGAGTCTGG + Intronic
928323946 2:30305208-30305230 TTTTTTCCAGAGATAGGGTCTGG + Intronic
928349722 2:30538622-30538644 TTTTTTTTTGAGATGGAGTCTGG - Intronic
928656449 2:33456913-33456935 TTTTTTTTTGAGATGGAGTCTGG + Intronic
929105312 2:38359464-38359486 TTTTTTTTTGAGATGGAGTCTGG - Intronic
929113231 2:38422833-38422855 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929116763 2:38451265-38451287 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929203455 2:39263078-39263100 TTTTTTTTTGAGATGGAGTCTGG - Intronic
929363346 2:41121744-41121766 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929599526 2:43196442-43196464 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
929903721 2:46027951-46027973 TTTTTTTTTGAGATGGAGTCGGG + Intronic
930111602 2:47683307-47683329 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
930213919 2:48673372-48673394 TTTTTTTTTGAGATGGAGTCTGG + Intronic
930452400 2:51558246-51558268 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
930640511 2:53850017-53850039 TTGTTGCCCAGGATGGAGTGCGG - Intergenic
930798219 2:55415295-55415317 TTGTTTTTCAAGATGGGGTCTGG - Intronic
930832804 2:55763225-55763247 TTTTTTGTAGAGATGGAGTCGGG + Intergenic
930865803 2:56120993-56121015 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931166179 2:59751441-59751463 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931269500 2:60689020-60689042 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
931273824 2:60726554-60726576 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931275139 2:60737826-60737848 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931418503 2:62103850-62103872 TTTTTTTCCAAGACAGGGTCTGG + Intronic
931617458 2:64174605-64174627 TGCTTTCCCAAGATGGGGTTGGG - Intergenic
931729253 2:65138513-65138535 TTTTTTTTTAAGATGGAGTTTGG - Intergenic
931782157 2:65588230-65588252 TTTTTTTGTAGGATGGAGTCTGG + Intergenic
932189874 2:69731990-69732012 TTTTTTTTTGAGATGGAGTCTGG + Intronic
932238137 2:70137419-70137441 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
932379819 2:71271660-71271682 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
932392679 2:71411007-71411029 TTTTTTGTCGAGATGGAGCCTGG + Intronic
932637003 2:73398853-73398875 TTTTTTTTTGAGATGGAGTCTGG + Intronic
932810106 2:74818287-74818309 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
933112406 2:78420370-78420392 TTTTCTCACAATTTGGAGTCTGG + Intergenic
933170418 2:79118666-79118688 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
933191432 2:79338232-79338254 TTTTTTTTTGAGATGGAGTCTGG - Intronic
933239335 2:79902636-79902658 TTTTTTTTTGAGATGGAGTCTGG + Intronic
933668663 2:84985815-84985837 TTTTTTTTTGAGATGGAGTCTGG - Intronic
933680511 2:85095696-85095718 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
933827290 2:86173751-86173773 TTTATTTCCAAGATTCAGTCGGG - Exonic
933848108 2:86342187-86342209 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
933960093 2:87402683-87402705 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
934763460 2:96868573-96868595 TTGTTGCCCAAGAGGGAGGCAGG + Intronic
934877716 2:97940795-97940817 TTTTTTTTTGAGATGGAGTCTGG - Intronic
935027693 2:99293001-99293023 TTTTTTTTTGAGATGGAGTCTGG + Intronic
935050810 2:99523433-99523455 TTTTTTTTGCAGATGGAGTCTGG - Intergenic
935546015 2:104399987-104400009 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
935789148 2:106575403-106575425 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
935967049 2:108489501-108489523 TTTTTTTTTGAGATGGAGTCTGG - Intronic
936385496 2:112024891-112024913 CTGTTTCCCAGGCTGGAGTCTGG - Intronic
936610014 2:113993087-113993109 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
936658406 2:114514789-114514811 TTTTTTTCCACGTTGGAGGCAGG + Intronic
936875238 2:117181191-117181213 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
936891556 2:117376698-117376720 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937102650 2:119283484-119283506 TTTTTTCTTGAGAGGGAGTCTGG + Intergenic
937277996 2:120698207-120698229 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
937352777 2:121177077-121177099 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
937400010 2:121574314-121574336 TTTTTTTTTGAGATGGAGTCTGG - Intronic
937423713 2:121779755-121779777 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937533137 2:122854299-122854321 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937696273 2:124811903-124811925 TTTTTGCCCAGGCTGGAGTGCGG - Intronic
937945761 2:127334619-127334641 TTTTTTGTAGAGATGGAGTCTGG + Intronic
937969533 2:127538575-127538597 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938060206 2:128248490-128248512 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938417420 2:131115364-131115386 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938511007 2:131944295-131944317 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
938712817 2:133990268-133990290 TTTTTAGCCAAGCTGGGGTCAGG - Intergenic
938855785 2:135308990-135309012 TTTTTTTTTGAGATGGAGTCTGG + Intronic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
939474055 2:142663405-142663427 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
939770669 2:146312435-146312457 TTATTTCCCAGCATGCAGTCTGG + Intergenic
940221329 2:151355108-151355130 TCTTTTTTTAAGATGGAGTCTGG + Intergenic
940651632 2:156446584-156446606 TTTTTTTTTAAGATGGAGTCTGG + Intronic
940876412 2:158901889-158901911 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
941283299 2:163579559-163579581 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
941436316 2:165477655-165477677 TTTTTTTTTGAGATGGAGTCTGG - Intronic
942092747 2:172509861-172509883 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
942770997 2:179520158-179520180 TTTTTTTTTAAGATGGAGACAGG - Intronic
942859748 2:180595456-180595478 TTTTTTGTAAAGATGGGGTCTGG + Intergenic
942884006 2:180900169-180900191 TTTTTTTTTGAGATGGAGTCAGG + Intergenic
943189558 2:184658459-184658481 TTTTTCCTCGAGATGGAGTCTGG - Intronic
943611088 2:190035417-190035439 TTTTTTTTTGAGATGGAGTCTGG - Intronic
943707879 2:191055208-191055230 TTTTTTTTTGAGATGGAGTCTGG + Intronic
944097585 2:195986141-195986163 TTTCCTCCCAAGATGGAGTTTGG - Intronic
944382844 2:199131587-199131609 TTTTTTTCCTCGATGGAGTTAGG - Intergenic
944563037 2:200960788-200960810 TTTTTTTCTAAGATGGAGTCTGG + Intronic
944572501 2:201058690-201058712 TTTTTTCTTGAGATGGGGTCTGG - Intronic
944652288 2:201843196-201843218 TTTTTTTATTAGATGGAGTCTGG + Intronic
944733746 2:202541390-202541412 TTGTTGCCCAGGATGGAGTACGG - Intronic
944789830 2:203113831-203113853 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945260383 2:207837643-207837665 TTTTTTTTTGAGATGGAGTCAGG + Intronic
945366774 2:208964250-208964272 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
945498286 2:210536330-210536352 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945620805 2:212134693-212134715 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945685622 2:212966078-212966100 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
945852868 2:215030590-215030612 TTTTTTTTTGAGATGGAGTCTGG - Intronic
945885723 2:215373689-215373711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
946114972 2:217453462-217453484 TCTTTTCCCAATATGGTTTCTGG + Intronic
946278322 2:218647409-218647431 TTTTTTTTTGAGATGGAGTCTGG - Intronic
946382219 2:219356610-219356632 TTTTTCCTTGAGATGGAGTCTGG - Intergenic
946801084 2:223416530-223416552 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
946856282 2:223953144-223953166 TTTTTTTCCGAGACAGAGTCTGG + Intergenic
947049414 2:226025016-226025038 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
947180160 2:227404378-227404400 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
947519561 2:230834135-230834157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
947538937 2:230961166-230961188 TTTTCTCCCCCGATGGAGACTGG - Intergenic
947573168 2:231251176-231251198 TTTTTTTTTGAGATGGAGTCTGG + Intronic
947920510 2:233867510-233867532 TTGTTGCCCAGGATGGAGTGCGG + Intergenic
948321094 2:237070278-237070300 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
948543491 2:238706684-238706706 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
948880373 2:240853957-240853979 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
949061846 2:241964842-241964864 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
1168743443 20:214971-214993 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1169161541 20:3383283-3383305 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1169179279 20:3548587-3548609 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1169211936 20:3770695-3770717 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1169618739 20:7480410-7480432 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1169651779 20:7877098-7877120 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1169785649 20:9356936-9356958 TTTTTTGCAGAGATGGGGTCTGG - Intronic
1169797587 20:9481350-9481372 TTTTTTCCCCAGATGGCATCTGG + Intergenic
1169805038 20:9550470-9550492 CTTATTCCCAAGATGGAGTGTGG - Intronic
1169892831 20:10472240-10472262 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1169977119 20:11342284-11342306 TTCTTTGCCAACATGGAGACAGG + Intergenic
1170021798 20:11844831-11844853 TTTTTTTCCAAGAATGACTCTGG + Intergenic
1170127967 20:12986967-12986989 TTTTTTCCTGAGATGGAGTCTGG + Intergenic
1170218618 20:13917807-13917829 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1170243772 20:14197753-14197775 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1170342043 20:15340148-15340170 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1170373751 20:15678050-15678072 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1170421819 20:16200837-16200859 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1170892959 20:20391571-20391593 ATTTGTCCCAAGAGTGAGTCTGG + Intronic
1171141026 20:22742683-22742705 TTTTTTTTCGAGATGGAATCTGG - Intergenic
1171392067 20:24808101-24808123 TTGTTTTCTGAGATGGAGTCTGG + Intergenic
1171560145 20:26116718-26116740 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1171859275 20:30380510-30380532 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1171969793 20:31557005-31557027 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1171970996 20:31565152-31565174 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1172335122 20:34109621-34109643 TTGTTTCCCAGGCTGGAGTGCGG - Intronic
1172749734 20:37242318-37242340 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1172983625 20:38964440-38964462 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1173033111 20:39380478-39380500 CTTTTGCCCAGGATGGAGTGCGG - Intergenic
1173105947 20:40133988-40134010 TATTTTCCCTGGATGGAGTTGGG + Intergenic
1173363114 20:42362081-42362103 TTTTTTGTGGAGATGGAGTCTGG - Intronic
1173486272 20:43443372-43443394 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1173492103 20:43491425-43491447 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1173576178 20:44114186-44114208 TTTTTCCCCATGATGGAGCTGGG - Intronic
1173609119 20:44353818-44353840 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1173647359 20:44641777-44641799 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1173697209 20:45028502-45028524 TTTTTTCCAAAGATGAGGTCTGG + Intronic
1173775346 20:45701748-45701770 TTTTTTGAGATGATGGAGTCTGG - Intronic
1174015601 20:47485630-47485652 TTTTTTTTCGAGATGGAGTTTGG - Intergenic
1174226483 20:49004778-49004800 TTATTTTCTAAGATGGAGTCTGG - Intronic
1174228749 20:49026489-49026511 TTTTTTTCCAAGATGGTGGTGGG + Intronic
1174296883 20:49552041-49552063 GTTTCTCCCCAGAAGGAGTCTGG - Intronic
1174320935 20:49741036-49741058 TTATTTTTCAAGTTGGAGTCTGG - Intergenic
1174661435 20:52216577-52216599 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1175143225 20:56876053-56876075 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1175145471 20:56892929-56892951 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1175243384 20:57566408-57566430 TTTTTTTCCAAGAAGTAGTAAGG - Exonic
1175270326 20:57729460-57729482 TTTTTTGTAAAGATGGACTCTGG - Intergenic
1175551239 20:59819347-59819369 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1176650904 21:9546135-9546157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1176781976 21:13207517-13207539 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1177142211 21:17369467-17369489 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177279919 21:18967657-18967679 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177280062 21:18970334-18970356 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177469238 21:21535761-21535783 TTTTTTCCCAAAATATAGCCTGG - Intronic
1177546671 21:22567832-22567854 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1177883500 21:26721306-26721328 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177886012 21:26746905-26746927 TTTTTTTTCAAGATGGGATCTGG + Intergenic
1177935154 21:27335833-27335855 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177991929 21:28046611-28046633 TTTTTTGCTTAGATGGTGTCAGG - Intergenic
1178077793 21:29028445-29028467 TTTTTTCCTGAGACGGAGTCTGG + Intronic
1178081116 21:29066068-29066090 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1178198358 21:30374824-30374846 TTTTTTTCCGAGACGGAGTCTGG + Intronic
1178240750 21:30897216-30897238 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1178319412 21:31593945-31593967 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1178697203 21:34803533-34803555 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1178878582 21:36431080-36431102 TTGTTTCTCAAGACGGAGTCTGG + Intergenic
1178905078 21:36630001-36630023 TCATTTCCCAAGATTGAGTGGGG - Intergenic
1178999958 21:37448116-37448138 TTGATTCCCAAAATGTAGTCGGG + Intronic
1179256037 21:39716071-39716093 TCATTTCCCAAGAGGGTGTCAGG + Intergenic
1179533196 21:42034052-42034074 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG + Intronic
1180065906 21:45412246-45412268 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1180242113 21:46516501-46516523 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1180476407 22:15713509-15713531 TTTTTTTTTAAGATGAAGTCTGG + Intronic
1181098576 22:20523238-20523260 TTCTCTCCCTGGATGGAGTCTGG + Intronic
1181378239 22:22477816-22477838 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1181740658 22:24919058-24919080 TTTTTTTTCGAGATGAAGTCTGG + Intronic
1181958637 22:26607032-26607054 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1182328211 22:29530506-29530528 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1182373253 22:29827084-29827106 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1182402342 22:30089362-30089384 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1182535339 22:30997808-30997830 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1182647686 22:31823519-31823541 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1183224532 22:36540407-36540429 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183225300 22:36545861-36545883 TTTTTTTTTAAGATGGAGTCCGG + Intergenic
1183287162 22:36974208-36974230 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183374119 22:37453019-37453041 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183479439 22:38055375-38055397 TTTGTTTCTGAGATGGAGTCTGG + Intergenic
1183619223 22:38962944-38962966 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1183679923 22:39322122-39322144 TTTTTTTCCGATACGGAGTCTGG + Intergenic
1183714109 22:39523690-39523712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183811705 22:40263026-40263048 TTTTTTTTTAAGACGGAGTCTGG - Intronic
1184053949 22:42031705-42031727 TTTTTTTTCAAGATAGAATCTGG + Intronic
1184056781 22:42057926-42057948 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1184129605 22:42509974-42509996 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1184185441 22:42861783-42861805 TTTTTTCTCGAGGCGGAGTCTGG + Intronic
1184348790 22:43929606-43929628 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1184830692 22:46984353-46984375 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1184917493 22:47580393-47580415 TTTCTCCCCAAAATGGTGTCTGG - Intergenic
1184919877 22:47598572-47598594 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1184971194 22:48021406-48021428 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1184999382 22:48235095-48235117 TTGTTGCCCAGGCTGGAGTCCGG + Intergenic
1185178489 22:49345737-49345759 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1185196507 22:49473752-49473774 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1185360076 22:50401217-50401239 TTTTTTTTTGAGATGGAGTCTGG + Intronic
949093091 3:52573-52595 TGTTTTCCCAAAATGGAGGAAGG + Intergenic
949258340 3:2077440-2077462 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
949461295 3:4297577-4297599 TTTTTTTTTGAGATGGAGTCTGG + Intronic
949658310 3:6247438-6247460 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
949962545 3:9324943-9324965 TTTTTTTTTGAGATGGAGTCTGG - Intronic
950041597 3:9923163-9923185 TTTTTTTTTGAGATGGAGTCTGG - Intronic
950378233 3:12589800-12589822 TTTTTTTTTCAGATGGAGTCTGG + Intronic
950512968 3:13444010-13444032 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
950538708 3:13597107-13597129 TTTTTTGTAGAGATGGAGTCTGG + Intronic
950898258 3:16473410-16473432 TTTTTTCCTGAGATAGAGTCTGG + Intronic
950918868 3:16672395-16672417 TTTCTCCCCAAAAGGGAGTCTGG - Intergenic
950975320 3:17236496-17236518 TTTTTTTTTGAGATGGAGTCTGG + Intronic
951297734 3:20959869-20959891 TGTTTTCAGAACATGGAGTCAGG + Intergenic
952440382 3:33321296-33321318 TTTTTTTTTGAGATGGAGTCAGG - Intronic
953521640 3:43648686-43648708 TTTTTTTTTAAGATGGAGTCTGG + Intronic
953640773 3:44705469-44705491 TTTTTTTCTGAGATGGACTCTGG - Intergenic
953643102 3:44728052-44728074 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
953837723 3:46361791-46361813 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
954016588 3:47697310-47697332 TTTTTTTTTTAGATGGAGTCTGG + Intronic
954295525 3:49672791-49672813 TTTTTTTTTAAGATGGACTCTGG + Intergenic
954339671 3:49942847-49942869 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954553974 3:51504047-51504069 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
954679040 3:52331634-52331656 TTTTTTTTTGAGATGGAGTCTGG + Intronic
954772917 3:52989409-52989431 TTTTTTTTTGAGATGGAGTCAGG - Intronic
954876930 3:53808400-53808422 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954880393 3:53831939-53831961 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954902656 3:54033361-54033383 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
955203142 3:56869796-56869818 TTTTTTTCCAGGCTGGAGCCTGG - Intronic
955286204 3:57644136-57644158 TTTTTTTTTGAGATGGAGTCTGG - Intronic
955700362 3:61676443-61676465 TTTTTTTTTGAGATGGAGTCTGG - Intronic
956042389 3:65158094-65158116 TTTTTTCTTAAGATGGAGAATGG - Intergenic
956075903 3:65505051-65505073 TTTTGTTCCAAGAGGGATTCAGG + Intronic
956186358 3:66566398-66566420 TTTTTTTCTGAGATGGGGTCTGG + Intergenic
956443499 3:69303315-69303337 TTTTTTTTTAAGATGGGGTCTGG - Intronic
956821680 3:72959644-72959666 TTTTTTCTTGAGATGGAATCTGG + Intronic
957201610 3:77143195-77143217 TTTTTTTTTTAGATGGAGTCTGG + Intronic
957569665 3:81930536-81930558 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
957594346 3:82242968-82242990 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
957773247 3:84721259-84721281 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
957881768 3:86224197-86224219 TTTTTTCCAAAGATTAAGCCTGG + Intergenic
957937630 3:86965143-86965165 TTTTTTCTTTTGATGGAGTCTGG - Intronic
958022859 3:88017243-88017265 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
958099220 3:88987587-88987609 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
958416208 3:93876575-93876597 TTTTTTTTTGAGATGGAGTCTGG - Intronic
958988528 3:100812891-100812913 TTTTTTCCCCAGACAGGGTCTGG + Intronic
959432371 3:106270720-106270742 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
959541279 3:107541828-107541850 TTTTTTTAAGAGATGGAGTCTGG + Intronic
959902033 3:111672481-111672503 ATTTTTCCCAAGACTGACTCAGG + Intergenic
960047037 3:113208982-113209004 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
960092324 3:113653589-113653611 TTTTTTTAATAGATGGAGTCTGG - Exonic
960195459 3:114761820-114761842 TTTTTTTTTGAGATGGAGTCTGG - Intronic
960232446 3:115244107-115244129 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
960406835 3:117271390-117271412 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
960462069 3:117948134-117948156 TATTCTCCCAAGATTGAATCAGG - Intergenic
960600326 3:119450813-119450835 TTTTTTTTTGAGATGGAGTCTGG - Intronic
960872011 3:122259639-122259661 TTTTTTTTTGAGATGGAGTCTGG + Intronic
961682218 3:128607123-128607145 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
961740361 3:129029587-129029609 TTTTTTTTTGAGATGGAGTCTGG + Intronic
961806653 3:129494221-129494243 TTTTTTGCAGAGATAGAGTCTGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
961969114 3:130940924-130940946 TTTTTTTTTTAGATGGAGTCTGG + Intronic
962340402 3:134577446-134577468 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
962475078 3:135748254-135748276 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
962567988 3:136683273-136683295 TTTTTTTTTGAGATGGAGTCTGG + Intronic
962750125 3:138428022-138428044 TTTTTTTATGAGATGGAGTCTGG - Intergenic
962987319 3:140547460-140547482 CTTTTTTTTAAGATGGAGTCTGG - Intronic
963185411 3:142410504-142410526 TTTTTTTTTGAGATGGAGTCTGG + Intronic
963601551 3:147383383-147383405 ATTTTTCCCAAGAAGGCATCAGG - Intergenic
963659290 3:148103961-148103983 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
963725411 3:148914614-148914636 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
963798137 3:149651839-149651861 TTTTTTTTTGAGATGGAGTCTGG + Intronic
963852242 3:150220547-150220569 TTTTTTTCCTAAATGGACTCTGG + Intergenic
964013124 3:151914542-151914564 TTTTTTTTCATGACGGAGTCTGG - Intergenic
964082501 3:152776610-152776632 TTTTTTTTCTAGATGGTGTCTGG + Intergenic
964148583 3:153496594-153496616 TTTTTTTCTGAGATGGTGTCTGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964269727 3:154941966-154941988 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
964329880 3:155590564-155590586 TTTTTTTTTGAGATGGAGTCTGG - Intronic
964411539 3:156403175-156403197 CTTTTTCCCAAAATGGTGTGAGG + Intronic
964759123 3:160116720-160116742 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
964807837 3:160631092-160631114 TTTTCTCCCCAGAAGGAATCTGG + Intergenic
964864501 3:161241430-161241452 TTTTTTTTTGAGATGGAGTCTGG + Intronic
964871088 3:161314355-161314377 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
965130350 3:164691138-164691160 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
965423048 3:168486472-168486494 TTTTGTCCCAAGATGAAGTTTGG - Intergenic
965502573 3:169473754-169473776 GTTTTTTCTAAGAGGGAGTCTGG - Intronic
965566171 3:170120559-170120581 TTTTTTTTTGAGATGGAGTCTGG - Intronic
965647722 3:170901569-170901591 TTTTTTTTTGAGATGGAGTCTGG + Intronic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
966048480 3:175584047-175584069 TTTTTTTCTGCGATGGAGTCTGG + Intronic
966095846 3:176202156-176202178 TTTTTTCCTGAGACGGAGTCTGG + Intergenic
966162984 3:176987244-176987266 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
966180237 3:177181466-177181488 TTTTTTTTTAAGACGGAGTCTGG - Intronic
966196789 3:177322030-177322052 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
966381140 3:179346779-179346801 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
966778795 3:183565664-183565686 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
966887308 3:184383787-184383809 TTTTTTTTTGAGATGGAGTCTGG + Intronic
966903086 3:184501229-184501251 TTTTTTTTTGAGATGGAGTCTGG + Intronic
966904945 3:184515211-184515233 TTTTTTTTTGAGATGGAGTCTGG - Intronic
967178056 3:186878517-186878539 TTTTTTTCTGAGACGGAGTCTGG + Intergenic
967662787 3:192133516-192133538 TTTTTTCCCAAGAAGCATGCTGG - Intergenic
967839125 3:193990500-193990522 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
968063130 3:195741361-195741383 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
968183489 3:196614685-196614707 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
968499515 4:941448-941470 TTTTTTCTTGAGATGGAGTCTGG + Intronic
968632789 4:1660867-1660889 TTTTTTTTTGAGATGGAGTCTGG - Intronic
968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG + Intronic
969120123 4:4902403-4902425 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
969203752 4:5626343-5626365 TTTTTTTTTGAGATGGAGTCTGG + Intronic
970076745 4:12230848-12230870 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
970438350 4:16057316-16057338 CTCTTTCCCAGGATGCAGTCAGG + Intronic
970622730 4:17841375-17841397 ATTTTTTCTAAAATGGAGTCTGG + Intronic
970849958 4:20589916-20589938 TTTTTTTTTGAGATGGAGTCTGG + Intronic
971248260 4:24949835-24949857 TCTTTCCCCAAGATGTTGTCAGG + Intronic
971337317 4:25735839-25735861 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
971342933 4:25787330-25787352 TTTTTTTCTGAGATGGAGTGTGG + Intronic
971408786 4:26347970-26347992 TTTTTTTTTAAGATGGAGTTTGG + Intronic
971728711 4:30348274-30348296 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
971805165 4:31349380-31349402 TTTTTTCCCAGTCTGGAGGCTGG + Intergenic
971913615 4:32829061-32829083 TTTCTTCCCCAAAGGGAGTCTGG + Intergenic
972004908 4:34089195-34089217 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972257658 4:37375578-37375600 TTTTTTTCCGAGACGGAGTCTGG + Intronic
972440882 4:39090483-39090505 TTTTTGCCCAGGCTGGAGTGCGG + Intronic
972478744 4:39477965-39477987 TTTTTTTTCAAGACAGAGTCTGG - Intergenic
972531278 4:39963446-39963468 TTTTTTTTTGAGATGGAGTCTGG - Intronic
972759916 4:42092996-42093018 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972787578 4:42341554-42341576 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
972790412 4:42366466-42366488 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972958336 4:44419916-44419938 TTTTTGTTCAATATGGAGTCCGG - Intronic
973135730 4:46704026-46704048 TTATTTACTGAGATGGAGTCTGG - Intergenic
973995646 4:56456101-56456123 TTTTTTCTTGAGACGGAGTCGGG + Intronic
974304937 4:60123937-60123959 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
974400039 4:61391869-61391891 TTTTTTTTTGAGATGGAGTCTGG + Intronic
974416951 4:61620651-61620673 TTTTTTTTTGAGATGGAGTCTGG + Intronic
974937827 4:68429543-68429565 TTGTTTCCCAGGCTGGAGTGCGG + Intergenic
974991998 4:69104333-69104355 ATTTTTATAAAGATGGAGTCTGG + Intronic
975404592 4:73975539-73975561 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
975477096 4:74835880-74835902 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
976198272 4:82554860-82554882 TTTATTCCACAGATAGAGTCTGG + Intronic
976923162 4:90462707-90462729 TATTCGCCCAAGCTGGAGTCTGG - Intronic
976950338 4:90820968-90820990 TATTTTCCAAAGAAGTAGTCTGG - Intronic
977255929 4:94740098-94740120 TTGTTGCCCAGGCTGGAGTCTGG + Intergenic
977516895 4:98031646-98031668 TTTTTGCCCAGGCTGGAGTGCGG - Intronic
977530956 4:98200006-98200028 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
977595482 4:98874802-98874824 TTTTTTTTGGAGATGGAGTCTGG + Intronic
977620039 4:99125736-99125758 TTCTTCCCCAAGAAGTAGTCTGG + Intronic
977689181 4:99884952-99884974 TTTTCTTCCAAGACAGAGTCTGG - Intronic
978444057 4:108763811-108763833 TTTTTTTTGAGGATGGAGTCTGG + Intergenic
978554190 4:109960631-109960653 GTTTTCCCCGAGATAGAGTCTGG - Intronic
978575940 4:110189953-110189975 TTTTTTTTTGAGATGGAGTCTGG - Intronic
979131861 4:117057021-117057043 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
979710145 4:123769962-123769984 TTTTTTTCCAAGATGAACTTGGG + Intergenic
979722380 4:123916582-123916604 TTGTTGCCCAGGCTGGAGTCTGG + Intergenic
979980794 4:127252725-127252747 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
980135024 4:128850299-128850321 TTTTTTTTTGAGATGGAGTCTGG - Intronic
980369388 4:131847554-131847576 TTTTCTCCCCTGATGGGGTCAGG - Intergenic
980648254 4:135674521-135674543 TTTTTTACGGAGATGGAGTCTGG - Intergenic
980939305 4:139258283-139258305 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
981251765 4:142611653-142611675 TTTTTTTTTGAGATGGAGTCTGG + Intronic
981620601 4:146693662-146693684 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
981695757 4:147557248-147557270 CTTATGCCCAAGATGGTGTCTGG - Intergenic
982149521 4:152437365-152437387 TTTTTTTTTGAGATGGAGTCTGG - Intronic
982270324 4:153579295-153579317 CTGTTTCCCAGGCTGGAGTCGGG - Intronic
982279620 4:153669607-153669629 TTTTTTTCTAAGACAGAGTCTGG + Intergenic
982511018 4:156283428-156283450 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
982712490 4:158770777-158770799 TTTGTACCCCTGATGGAGTCTGG - Intronic
982737348 4:159020106-159020128 TTTTTTTTAAAGATGGAGTCTGG - Intronic
982920301 4:161266354-161266376 TTTTTTTATGAGATGGAGTCTGG - Intergenic
983016138 4:162614926-162614948 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983027913 4:162759786-162759808 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
983081183 4:163387369-163387391 CTTTTCCCCAAGATGTACTCAGG + Intergenic
983199499 4:164845447-164845469 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983294921 4:165854673-165854695 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983420362 4:167508237-167508259 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
983682544 4:170370527-170370549 TTTGTTCCCATGATGAAGTTTGG + Intergenic
984031347 4:174607605-174607627 TTTTTCCCCAAAAGAGAGTCTGG - Intergenic
984488471 4:180402115-180402137 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
984648583 4:182245203-182245225 TTGTTTCCCAAGACTGTGTCAGG + Intronic
984900964 4:184586059-184586081 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
985009596 4:185568930-185568952 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
985096907 4:186421804-186421826 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
985110689 4:186544019-186544041 TTTCTTCTTGAGATGGAGTCTGG + Intronic
985124208 4:186675428-186675450 TTATTGCCCAGGATGGAGTGCGG - Intronic
985208587 4:187568003-187568025 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
985272334 4:188206324-188206346 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1202754523 4_GL000008v2_random:46990-47012 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
986189372 5:5480259-5480281 TTTTTTTTTGAGATGGAGTCTGG + Intronic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986520666 5:8614353-8614375 TTTTTGCACAACATGGAGTGAGG + Intergenic
986539263 5:8827005-8827027 TTATTTTCCAAGATGGAGTAGGG + Intergenic
987055731 5:14189735-14189757 TTTTTTTTCAAGATGGGGTGAGG + Intronic
987070920 5:14336220-14336242 ATTTTTGCCAAGGTGGAGTCAGG - Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
987247411 5:16062445-16062467 ATTTTTTTCTAGATGGAGTCTGG + Intergenic
987519246 5:18958139-18958161 TTCTTTCCGGAGATGGGGTCTGG + Intergenic
988088087 5:26497251-26497273 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
988141020 5:27240264-27240286 TAATCTCCCAAGATTGAGTCAGG - Intergenic
988242922 5:28636746-28636768 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
988377832 5:30460207-30460229 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
988533141 5:32042558-32042580 TTTCTTTTTAAGATGGAGTCTGG - Intronic
988588191 5:32526098-32526120 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
988787443 5:34578015-34578037 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
989035093 5:37162689-37162711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989049397 5:37304236-37304258 TTTTTTTTTGAGATGGAGTCTGG - Intronic
989088477 5:37701772-37701794 TTTTTTTTTGAGATGGAGTCTGG - Intronic
989277011 5:39601283-39601305 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
989385516 5:40851317-40851339 TTTTTTTTTTAGATGGAGTCTGG - Intronic
989603257 5:43219730-43219752 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989604349 5:43229646-43229668 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989780277 5:45256359-45256381 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
990431478 5:55738801-55738823 TTTTTTCCAAAGAAGGAATTAGG - Intronic
990722484 5:58712534-58712556 TTTTTTCTCGAGACAGAGTCTGG + Intronic
991154802 5:63420510-63420532 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
991308366 5:65206686-65206708 TTTTTTTTTGAGATGGAGTCTGG - Intronic
991467035 5:66924403-66924425 TTTTTTTTTGAGATGGAGTCTGG + Intronic
991539342 5:67709129-67709151 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
991675012 5:69082019-69082041 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
991693475 5:69248415-69248437 TTGTTTCCCAGGCTGGAGTGTGG + Intronic
991710754 5:69406028-69406050 TTTTTTTTTGAGATGGAGTCTGG - Intronic
991721069 5:69494204-69494226 TGTTTTTCCGAGACGGAGTCTGG + Intronic
992004311 5:72462555-72462577 TTTTTTTTGGAGATGGAGTCTGG + Intronic
992069957 5:73138919-73138941 TTTTCTCCCAGGCTGGAGTGTGG - Intergenic
992130442 5:73686528-73686550 TTTTTTTTCGAGACGGAGTCTGG + Intronic
992146467 5:73854818-73854840 TTTTTTTTTGAGATGGAGTCTGG - Intronic
992256430 5:74925689-74925711 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
992441035 5:76798001-76798023 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
992559801 5:77939801-77939823 TTTTTTCTTGAGATGGAGCCTGG - Intergenic
992673685 5:79084286-79084308 TTTGTTTCTGAGATGGAGTCTGG + Intronic
992688877 5:79223916-79223938 TTTGTTTTTAAGATGGAGTCTGG - Intronic
992821770 5:80504875-80504897 TATTTTCCCAGGATGAAGTTGGG - Intronic
993196341 5:84751624-84751646 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
993597940 5:89882967-89882989 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
993806530 5:92417506-92417528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
993989549 5:94639050-94639072 TTTTTTTTTGAGATGGAGTCTGG + Intronic
994005322 5:94830060-94830082 TTAATTCCCAAGAAAGAGTCTGG + Intronic
994701168 5:103137172-103137194 TTTTTTTTTGAGATGGAGTCTGG + Intronic
994737071 5:103568482-103568504 TTTTCCCCCGAGATGGAGTCTGG - Intergenic
994912375 5:105927885-105927907 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
995280260 5:110327092-110327114 TTTTTTGTAAAGATGGTGTCTGG + Intronic
995444031 5:112222951-112222973 TTTTTTTTTAAGATGGAGTCTGG + Intronic
995510133 5:112900847-112900869 TTTTTTTTAGAGATGGAGTCTGG + Intronic
995576477 5:113541201-113541223 TTTTTTTTTGAGATGGAGTCTGG + Intronic
996168111 5:120251683-120251705 TTTCTTCCCTAGAAGGAGCCGGG + Intergenic
996235553 5:121125839-121125861 TTCTTTCCCAAGATGGAACCTGG - Intergenic
996554002 5:124759037-124759059 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
996706633 5:126504832-126504854 TGTTCTCCCATGATGTAGTCAGG + Intergenic
997218587 5:132136529-132136551 TTTCCCCCCGAGATGGAGTCTGG - Intergenic
997277753 5:132611692-132611714 TTTTTTTTTAAGACGGAGTCTGG - Intronic
997327687 5:133035695-133035717 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
997538124 5:134638578-134638600 TTTTTTCTTGAGATGGATTCTGG - Intronic
997576921 5:134986153-134986175 TTTTTTTCTGAGATGGAGTTTGG + Intronic
997936561 5:138117170-138117192 TTGTTCCCCATGCTGGAGTCTGG - Intronic
998423570 5:142008713-142008735 TTTTTTTTCAAGATAGAGTCTGG - Intronic
998480033 5:142455077-142455099 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
998568097 5:143233727-143233749 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
998750379 5:145315079-145315101 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
998782390 5:145672356-145672378 TTGATTCCCAAGATGGAGGAAGG - Intronic
998912440 5:146974699-146974721 TTTTTTTTTGAGATGGAGTCTGG + Intronic
998930457 5:147175631-147175653 CTATTTCCCAAGATGGACTATGG - Intergenic
999082439 5:148856985-148857007 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
999241094 5:150127820-150127842 TTTTTTTTTAAGATGGAGTCTGG - Intronic
999393451 5:151211532-151211554 TTTTTTTTTGAGATGGAGTCTGG + Intronic
999641285 5:153675866-153675888 TTTTTTTTTGAGATGGAGTCTGG + Intronic
999849950 5:155527119-155527141 TTTTTTCCCAAGCTGGTGTCAGG - Intergenic
1000183234 5:158833284-158833306 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1000298631 5:159934804-159934826 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1000305471 5:159990532-159990554 TTTGTTTTTAAGATGGAGTCTGG - Intergenic
1000635632 5:163640843-163640865 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1000694641 5:164365776-164365798 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1000767835 5:165314500-165314522 TTTTTTCCTGAGACAGAGTCTGG + Intergenic
1000797246 5:165680195-165680217 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1001612411 5:173013561-173013583 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1001627773 5:173150847-173150869 TTTTTTTTTAAGACGGAGTCTGG + Intronic
1001835862 5:174831884-174831906 TTTTTTCTCACTGTGGAGTCAGG + Intergenic
1001874833 5:175190811-175190833 TTTTTTCTTGAGAGGGAGTCTGG - Intergenic
1002154291 5:177264046-177264068 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1002257337 5:177967805-177967827 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1002391394 5:178915337-178915359 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1002504066 5:179666641-179666663 TTTTTTGTAAAGATGGAGTCTGG + Intergenic
1002567932 5:180122702-180122724 TTGTTTCCCAGGCTGGAGTGCGG - Intronic
1002578489 5:180192754-180192776 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1002670622 5:180863325-180863347 TTGTTGCCCAGGCTGGAGTCAGG + Intergenic
1002721216 5:181262225-181262247 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1002944005 6:1743529-1743551 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1003106430 6:3220108-3220130 TTTTTTTCTGAGATGGGGTCTGG + Intergenic
1003905316 6:10694221-10694243 TTTTTGCCCAGGCTGGAGTCCGG - Intronic
1004223376 6:13765876-13765898 TTTTTTCCAAAGAGGGTCTCAGG + Intergenic
1004224066 6:13770227-13770249 TTTTTTTTAGAGATGGAGTCTGG + Intergenic
1004380255 6:15126581-15126603 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1004571125 6:16846287-16846309 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1004651954 6:17618575-17618597 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1004716041 6:18217388-18217410 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1004734523 6:18391854-18391876 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1004846433 6:19648106-19648128 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
1005043258 6:21618485-21618507 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1005142222 6:22646194-22646216 TTTTTGCCCATGCTGGAGTGTGG + Intergenic
1005393614 6:25359068-25359090 TTTTCTGCCAAGATGGACACTGG + Intronic
1005480868 6:26254126-26254148 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005572937 6:27163865-27163887 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005903883 6:30243488-30243510 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006179132 6:32143406-32143428 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006353478 6:33539213-33539235 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006530787 6:34651802-34651824 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1007388180 6:41533454-41533476 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1007785060 6:44275104-44275126 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1007855155 6:44847976-44847998 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1007891563 6:45298526-45298548 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1008153623 6:47987786-47987808 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1008190362 6:48448475-48448497 TTTTTCTCCGAGACGGAGTCTGG - Intergenic
1008314404 6:50022521-50022543 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1008611688 6:53190268-53190290 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1008650611 6:53557443-53557465 TTTCTCCCCAATAGGGAGTCTGG - Intronic
1009027034 6:58012463-58012485 TTTTTTCCCATGAAAGAATCTGG - Intergenic
1009202575 6:60763934-60763956 TTTTTTCCCATGAGAGAATCTGG - Intergenic
1009211565 6:60869024-60869046 TGTCTTTCCAAGATGGAGGCTGG - Intergenic
1009520415 6:64675437-64675459 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1009617714 6:66031994-66032016 TTGTTTTTCAAGAAGGAGTCTGG - Intergenic
1009748102 6:67846403-67846425 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1009768788 6:68118327-68118349 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1009814008 6:68707097-68707119 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1009949751 6:70381652-70381674 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1010150464 6:72726220-72726242 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1010231916 6:73542375-73542397 TTTTTTCTGGAGACGGAGTCTGG + Intergenic
1010365531 6:75046664-75046686 TTTTTTGTTTAGATGGAGTCTGG - Intergenic
1010715806 6:79228629-79228651 TTTTTTCCCAAAATTGTTTCTGG - Intronic
1010887016 6:81256434-81256456 TTATTTCTTGAGATGGAGTCTGG + Intergenic
1011010529 6:82698570-82698592 TCTTTTGCCAAGATGTAGGCAGG + Intergenic
1011330360 6:86198424-86198446 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1011410963 6:87065653-87065675 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1011472775 6:87724546-87724568 TTGTTGCCCAGGCTGGAGTCTGG + Intergenic
1011655167 6:89545199-89545221 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1011676323 6:89737733-89737755 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1011794204 6:90934989-90935011 TTTTTACCCAAGCTGGAGATAGG - Intergenic
1012497883 6:99854784-99854806 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1012519221 6:100100424-100100446 TTTTTGCCCAGAATGGAGTGCGG - Intergenic
1012541645 6:100368115-100368137 TTCTTGCCCAAGCTGGAGTGTGG - Intergenic
1012708450 6:102565733-102565755 TTTTTCCCTGAGATGGAGTCTGG + Intergenic
1012905472 6:105059912-105059934 TTTTTTTTTAAGATGGAGTTTGG + Intronic
1012924531 6:105254216-105254238 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1013104614 6:107016303-107016325 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1013133972 6:107261918-107261940 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1013452656 6:110300430-110300452 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1014060843 6:117070099-117070121 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1014087035 6:117358471-117358493 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1014110378 6:117614002-117614024 TTTCTCCCCAAAAGGGAGTCTGG - Intergenic
1014623755 6:123701151-123701173 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1014753938 6:125282334-125282356 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1014911091 6:127093917-127093939 TTTTTTTTCTAGATGAAGTCTGG + Intergenic
1015016234 6:128416634-128416656 TTTTTTTTTAAGATGGAGTCTGG - Intronic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015244145 6:131059124-131059146 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1015549297 6:134395394-134395416 TCTTTTGCCAGAATGGAGTCAGG + Intergenic
1015640301 6:135325036-135325058 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1015720678 6:136237802-136237824 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1015791687 6:136969795-136969817 CTTTTCCCCAAGATGGAGCCTGG - Intergenic
1016082026 6:139867752-139867774 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1016102722 6:140122466-140122488 TTTTTCCACAATAAGGAGTCAGG - Intergenic
1016165297 6:140935074-140935096 GTTTTTCACGAGATGGGGTCTGG + Intergenic
1016210649 6:141529946-141529968 TTTATTCCCAAGAAGCAGTGAGG - Intergenic
1016287664 6:142491204-142491226 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1016430320 6:143977483-143977505 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1016457681 6:144247919-144247941 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1016802872 6:148184282-148184304 TTTTTTCCCCAGACAGGGTCTGG + Intergenic
1016819642 6:148335284-148335306 TTTTTTCCTGAGACAGAGTCTGG - Intronic
1016858027 6:148691811-148691833 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1017395412 6:153993179-153993201 TTTTTTTTCAAGATGGACTAGGG + Intergenic
1018297519 6:162364990-162365012 TTTTTTGCCAATATGTAGTGTGG + Intronic
1018313484 6:162533957-162533979 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1018688377 6:166321893-166321915 TTTTTTATTGAGATGGAGTCTGG + Intronic
1019091647 6:169540439-169540461 TTTTTTCTTTAGAGGGAGTCTGG + Intronic
1019189254 6:170241332-170241354 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1019234899 6:170603513-170603535 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1019389214 7:776322-776344 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1019500791 7:1363798-1363820 TTTATTTTCGAGATGGAGTCAGG - Intergenic
1019554775 7:1623683-1623705 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1019747248 7:2707833-2707855 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1019936578 7:4262039-4262061 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1019952671 7:4386139-4386161 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1019974430 7:4569316-4569338 TTTTTTGAAGAGATGGAGTCTGG + Intergenic
1019988649 7:4676929-4676951 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1020074883 7:5251377-5251399 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1020088942 7:5326768-5326790 TTTTTGCCCAGGCTGGAGTGTGG - Intronic
1020093426 7:5354164-5354186 TTTTTGCCCAGGCTGGAGTACGG - Intronic
1020111384 7:5450068-5450090 TTTTTTCTAGAGATAGAGTCTGG + Intronic
1020188906 7:5979690-5979712 TTTTTTTCAAAGATAGAGACAGG + Intronic
1020294010 7:6745063-6745085 TTTTTTTCAAAGATAGAGACAGG - Intergenic
1020842878 7:13242867-13242889 TTTTTTCCCAAGATATATTTTGG - Intergenic
1020992662 7:15220227-15220249 TTTTTCCTGGAGATGGAGTCTGG + Intronic
1021146916 7:17100176-17100198 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1021466063 7:20944754-20944776 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1021497222 7:21289166-21289188 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1021520358 7:21533993-21534015 TTTTTACCCAAGAGTCAGTCAGG + Intergenic
1021565412 7:22011899-22011921 TTTTTGCCCAGGTTGGAGTACGG + Intergenic
1022147797 7:27563908-27563930 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1022363251 7:29684615-29684637 TTTCTTCCCAGGATGGAGACCGG + Intergenic
1022698145 7:32729172-32729194 TTTCTTCCCAGGATGGAGACCGG - Intergenic
1022749081 7:33204393-33204415 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1022834524 7:34101222-34101244 TTTTTTCCCATGCTGGAGAAAGG + Intronic
1023203421 7:37722707-37722729 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1023820698 7:43979049-43979071 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1023917904 7:44604138-44604160 TGTCTCCCCAAGATGGAATCTGG - Intergenic
1023928262 7:44687107-44687129 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1023957464 7:44898377-44898399 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1024152602 7:46588082-46588104 TTTTTTAATTAGATGGAGTCTGG - Intergenic
1024260002 7:47567017-47567039 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1024432366 7:49303708-49303730 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1024523581 7:50329059-50329081 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1024723993 7:52171347-52171369 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1024914834 7:54487731-54487753 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1024998975 7:55297886-55297908 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1025042393 7:55658708-55658730 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1025167771 7:56727952-56727974 TTTTTTACAGAGATGGAGTCTGG - Intergenic
1025204229 7:56982444-56982466 TTTTTTTGTGAGATGGAGTCAGG - Intergenic
1025518287 7:61683618-61683640 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1025542613 7:62112266-62112288 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1025667711 7:63594489-63594511 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1025860447 7:65321955-65321977 TTTTATCCCAGGAGAGAGTCAGG + Intergenic
1026075977 7:67168721-67168743 TTTTCTTTTAAGATGGAGTCTGG + Intronic
1026080945 7:67220213-67220235 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1026083991 7:67247894-67247916 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026086374 7:67266509-67266531 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026185602 7:68080541-68080563 TTTTTTTTAAAGATGGAGTTTGG - Intergenic
1026282775 7:68936404-68936426 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1026313367 7:69207383-69207405 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026626207 7:71994862-71994884 TTTTTTTTCGAGACGGAGTCTGG + Intronic
1026690774 7:72548320-72548342 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1026693041 7:72566134-72566156 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1026696140 7:72593808-72593830 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1026700877 7:72643573-72643595 TTTTCTTTTAAGATGGAGTCTGG - Intronic
1026767216 7:73167681-73167703 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026771055 7:73199308-73199330 TTTTTTTCCCAGATGGAGTATGG - Intergenic
1026772142 7:73209275-73209297 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026775394 7:73227860-73227882 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1026838798 7:73656450-73656472 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027011923 7:74752705-74752727 TTTTTTTCCCAGATGGAGTATGG - Intronic
1027013011 7:74762668-74762690 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1027016251 7:74781231-74781253 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027043685 7:74977390-74977412 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1027071777 7:75164706-75164728 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1027075030 7:75183366-75183388 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027076118 7:75193346-75193368 TTTTTTTCCCAGATGGAGTATGG + Intergenic
1027079962 7:75224968-75224990 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027164024 7:75822088-75822110 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027246676 7:76372337-76372359 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027270230 7:76514892-76514914 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027558359 7:79694875-79694897 TTGTTTACCAAGCGGGAGTCTGG + Intergenic
1027837575 7:83264797-83264819 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1028726708 7:94096426-94096448 TTTTTTTGGTAGATGGAGTCTGG + Intergenic
1029082454 7:97985405-97985427 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1029100006 7:98121618-98121640 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1029143530 7:98429292-98429314 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1029248025 7:99216571-99216593 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
1029292141 7:99510249-99510271 TTTTTTTTTAAGACGGAGTCTGG + Intronic
1029370502 7:100147759-100147781 TTTTGTCCCCAGATTCAGTCCGG - Intergenic
1029462501 7:100704526-100704548 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1029525360 7:101090592-101090614 TTTTTTTTCGAGATGGGGTCTGG - Exonic
1029628664 7:101736509-101736531 TTTTTTTCTGAGGTGGAGTCTGG + Intergenic
1029703076 7:102260416-102260438 TTTGTTTTTAAGATGGAGTCTGG + Intronic
1029732786 7:102448703-102448725 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1029748978 7:102532480-102532502 TTTTTTTTTAAGATGGAGTCTGG + Intergenic
1029766921 7:102631588-102631610 TTTTTTTTTAAGATGGAGTCTGG + Intronic
1029894639 7:103970152-103970174 TTTTTTTTAGAGATGGAGTCTGG + Intronic
1029984453 7:104910137-104910159 TTTTTTTTTAAGACGGAGTCTGG + Intergenic
1030878555 7:114846882-114846904 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1030981418 7:116188855-116188877 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1031160390 7:118160597-118160619 TTTCTTGCCAGAATGGAGTCTGG + Intergenic
1031409493 7:121423828-121423850 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1032055986 7:128684601-128684623 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1032166016 7:129545518-129545540 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1032172984 7:129601256-129601278 TTTTTTTTCGAGATGGAGTCTGG + Intergenic
1032213344 7:129936580-129936602 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1032320298 7:130880267-130880289 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1032888671 7:136169803-136169825 TTTTTTTTCGAGACGGAGTCTGG + Intergenic
1033120023 7:138659478-138659500 TTTTTTTTCGAGATAGAGTCTGG - Intronic
1033211161 7:139461233-139461255 TTTTTTTTTTAGATGGAGTCTGG - Intronic
1033225413 7:139558688-139558710 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1033271869 7:139939357-139939379 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1033772309 7:144566112-144566134 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1033782039 7:144683197-144683219 TTTTTTCCTGAAATGGAGTCTGG + Intronic
1033815231 7:145063108-145063130 TTTTTTTTTAAGACGGAGTCTGG + Intergenic
1033889603 7:145995029-145995051 TTTTTTTTCAAGATACAGTCTGG + Intergenic
1034043100 7:147899879-147899901 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1034150959 7:148915032-148915054 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1034250282 7:149684984-149685006 TCTTTGTCCCAGATGGAGTCTGG - Intergenic
1034280960 7:149853924-149853946 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1034313961 7:150112641-150112663 TTTTTTCCCTTGATGGAGGAGGG - Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1034657853 7:152743494-152743516 TTTTTTTCCAAGATGGAGTCTGG - Intergenic
1034698678 7:153077740-153077762 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1034778921 7:153859334-153859356 CTTTCTCTCAAGCTGGAGTCGGG + Intergenic
1035229508 7:157456045-157456067 TTTTTTTCTTAGATGGAGTCTGG + Intergenic
1035681938 8:1494714-1494736 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1035855948 8:2976524-2976546 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1035871641 8:3141807-3141829 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1036020110 8:4834943-4834965 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1036132932 8:6133281-6133303 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1036419804 8:8585115-8585137 TTTTTTTTTAAGATTGAGTCTGG + Intergenic
1036485951 8:9178805-9178827 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
1036516401 8:9448009-9448031 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1036530022 8:9576480-9576502 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1036947022 8:13103826-13103848 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1036976970 8:13424582-13424604 TTTCTTTCTGAGATGGAGTCTGG + Intronic
1037339287 8:17825350-17825372 TTCTTTTCTGAGATGGAGTCTGG - Intergenic
1037359958 8:18062880-18062902 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1037927212 8:22853055-22853077 TTTTAGCCCAAGATGGGGGCTGG - Intronic
1038366971 8:26946417-26946439 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1038529092 8:28302908-28302930 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1038629571 8:29228453-29228475 TATTTTTTTAAGATGGAGTCTGG - Intronic
1038656619 8:29458401-29458423 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1038659668 8:29486282-29486304 TTATTTCCCAAGCTGAATTCAGG - Intergenic
1038729627 8:30115343-30115365 TTTTTTTTTAAGATGGGGTCTGG - Intronic
1038851051 8:31276708-31276730 TTTTTTTTTTAGATGGAGTCTGG + Intergenic
1038987834 8:32832811-32832833 CTCCTTCCCAAGATGGAGTCTGG + Intergenic
1039537188 8:38327364-38327386 TTTTTTTTTAAGATGGAATCTGG + Intronic
1039741512 8:40387099-40387121 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1040045017 8:42953550-42953572 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1040432024 8:47352262-47352284 TTTTTTGTTGAGATGGAGTCTGG - Intronic
1040479954 8:47816175-47816197 TTTTTGCCCAGGCTGGAGTGCGG - Intronic
1040664950 8:49620828-49620850 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1040940709 8:52830034-52830056 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1041232321 8:55766386-55766408 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG + Intronic
1041515176 8:58691794-58691816 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1041772873 8:61490947-61490969 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1042304645 8:67318223-67318245 TTTTTTCTTGAGACGGAGTCTGG - Intronic
1042369514 8:67975713-67975735 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1042539746 8:69896307-69896329 TTTTTCTCCAAGATGTAGTCTGG - Intergenic
1042544391 8:69937969-69937991 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1042551978 8:70002168-70002190 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1042553798 8:70017418-70017440 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1042557392 8:70044795-70044817 TTTTTTTTCCAGACGGAGTCTGG + Intergenic
1043421811 8:80105741-80105763 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1043442336 8:80287313-80287335 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1043465995 8:80507600-80507622 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1043741966 8:83825262-83825284 TTGTTGCCCAGGATGGAGTGAGG - Intergenic
1043856577 8:85272265-85272287 TTTTTTCCTGAGACAGAGTCTGG + Intronic
1044111992 8:88286585-88286607 TTTTTTTTTAAGATGGAGTCTGG + Intronic
1044255977 8:90061893-90061915 TTTTTTCTCAAGATGGTTTTTGG - Intronic
1044340786 8:91044322-91044344 TTTTTTTCCAAGCAGGAGGCAGG - Intergenic
1044640643 8:94377530-94377552 TTTTTTTCCAAGACAGGGTCTGG - Intronic
1044719062 8:95128384-95128406 TTTTTTCTTGAGACGGAGTCTGG - Intergenic
1044823442 8:96174788-96174810 TTTTTTGCCTTGATGGAATCAGG - Intergenic
1044856534 8:96481699-96481721 TTTGTTTCAGAGATGGAGTCTGG - Intergenic
1044985627 8:97754072-97754094 TTTTTTTTCATGACGGAGTCTGG - Intergenic
1044997946 8:97855014-97855036 TTTTTTCCTGAGATGGAGTCTGG - Intergenic
1045062137 8:98419653-98419675 ATTTCTCCCAAGGTGGAGACAGG - Intronic
1045213791 8:100126794-100126816 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1045274382 8:100689439-100689461 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1045435249 8:102156945-102156967 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1045444840 8:102250103-102250125 TTTTTTTTCCAGATGGAGTCTGG + Intergenic
1045540937 8:103084528-103084550 TTTTTTGTAAAGATGGGGTCTGG - Intergenic
1045801791 8:106110554-106110576 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1046457246 8:114482984-114483006 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1046579025 8:116068585-116068607 TTTTTCCCCACAATGGGGTCTGG - Intergenic
1047014000 8:120703134-120703156 TTTTTTTGAGAGATGGAGTCTGG + Intronic
1047106333 8:121734595-121734617 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1047233768 8:123020466-123020488 TATTTTTTCAAGATGGGGTCTGG - Intronic
1047323416 8:123811881-123811903 TTTTTCCCCGAGATGGAGTCTGG + Intronic
1047409709 8:124614422-124614444 TCTTTTCCCAATGTGGAGACAGG + Intronic
1047490018 8:125366508-125366530 TTTTTTTCTGAGACGGAGTCTGG - Intronic
1047540499 8:125760733-125760755 TTTATTACCAAGCTAGAGTCAGG + Intergenic
1047569907 8:126086114-126086136 TTTTTTCCTGAGATAGGGTCTGG - Intergenic
1047624036 8:126637322-126637344 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1047833976 8:128667776-128667798 TTCTTTCCCCACATGGAGTATGG - Intergenic
1048913394 8:139158451-139158473 TTTTTTCCCCAGACGAACTCTGG - Intergenic
1049723568 8:144133707-144133729 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1049723680 8:144134995-144135017 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1049727786 8:144158002-144158024 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1049954639 9:681034-681056 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1050083608 9:1940974-1940996 TTTTTTTCTGAGACGGAGTCTGG - Intergenic
1050113699 9:2241983-2242005 TTTCTTCCCAAGATCCACTCCGG + Intergenic
1050600169 9:7242643-7242665 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1050604960 9:7291065-7291087 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1050706199 9:8401174-8401196 TTTTTTTTCCAGATGGGGTCTGG + Intronic
1051414267 9:16822079-16822101 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1051419416 9:16874863-16874885 TTTTTTTTCAAGACGGAGTCTGG - Intergenic
1051633060 9:19157765-19157787 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1052015466 9:23459293-23459315 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1052110034 9:24571173-24571195 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1052793267 9:32897887-32897909 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1052906927 9:33843488-33843510 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1053060297 9:35025373-35025395 TTTCTTCCCGAAAGGGAGTCTGG + Intergenic
1053389103 9:37720655-37720677 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1053519445 9:38763306-38763328 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1053521994 9:38789951-38789973 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1053574665 9:39346149-39346171 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1053601327 9:39612598-39612620 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1053793985 9:41708492-41708514 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1053839228 9:42174396-42174418 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1053858974 9:42366394-42366416 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054096229 9:60904839-60904861 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1054117688 9:61180775-61180797 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1054151185 9:61606356-61606378 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054182396 9:61920510-61920532 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054194159 9:62013939-62013961 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1054252209 9:62729840-62729862 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054470965 9:65537468-65537490 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054566324 9:66764339-66764361 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054590066 9:67001791-67001813 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1054644248 9:67574752-67574774 TTTTTTCTTGAGATGGAGTCTGG + Intergenic
1054656114 9:67667969-67667991 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054776516 9:69128532-69128554 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1054946944 9:70805520-70805542 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1055039635 9:71855483-71855505 TTCTTTTCTGAGATGGAGTCTGG + Intergenic
1056050584 9:82764336-82764358 TTTTTTTCCCTGATAGAGTCAGG + Intergenic
1056312945 9:85359373-85359395 TTTTTTTCCAAGATGGTGGACGG - Intergenic
1056534816 9:87518121-87518143 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1056581945 9:87894991-87895013 TCCTTTGCCAAGATGGTGTCTGG - Intergenic
1056855147 9:90121390-90121412 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1056988144 9:91384553-91384575 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1057017621 9:91666455-91666477 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1057795601 9:98155356-98155378 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1058434755 9:104952129-104952151 TTTTTTTCTGAGAAGGAGTCTGG + Intergenic
1058872743 9:109216634-109216656 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1058928134 9:109689212-109689234 TTTTTTTTTTAGATGGAGTCTGG + Intronic
1059144802 9:111889596-111889618 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
1059311702 9:113392827-113392849 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1059916538 9:119109638-119109660 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1059969277 9:119648294-119648316 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1060126458 9:121052438-121052460 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1060291652 9:122308396-122308418 TTTTTTTTTAAGATGGGGTCAGG + Intronic
1060297377 9:122352001-122352023 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060635787 9:125199149-125199171 TTTTTTCTTGAGACGGAGTCTGG + Intergenic
1060643801 9:125261404-125261426 TTTTTTTTCGAGACGGAGTCTGG - Intergenic
1060800675 9:126543536-126543558 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1060957110 9:127649874-127649896 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1061041089 9:128140962-128140984 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1061057032 9:128228969-128228991 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1061067462 9:128287439-128287461 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1061143756 9:128784861-128784883 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1061143919 9:128786172-128786194 TTTTTGCCCAGGTTGGAGTGCGG + Intergenic
1061150491 9:128825341-128825363 TTCTTTTTTAAGATGGAGTCTGG + Intronic
1061182855 9:129035254-129035276 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1061186249 9:129055835-129055857 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1061632889 9:131884617-131884639 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1061696676 9:132381203-132381225 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1061707280 9:132462777-132462799 TTGTTGCCCAAGCTGGAGTGCGG - Intronic
1061746983 9:132747457-132747479 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062415318 9:136446115-136446137 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1062676213 9:137746084-137746106 TTTTTTCCCCAGGTGGATTTTGG + Intronic
1062683326 9:137796690-137796712 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1062726959 9:138079729-138079751 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1062734635 9:138128731-138128753 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1203628637 Un_KI270750v1:49686-49708 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1185608929 X:1382761-1382783 TTTTTTTTGGAGATGGAGTCAGG + Intergenic
1185682394 X:1899280-1899302 TTTTTTTCTGAGATAGAGTCTGG + Intergenic
1185710713 X:2301399-2301421 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1185757579 X:2663947-2663969 TTTTTTTTTTAGATGGAGTCTGG - Intergenic
1185837587 X:3359762-3359784 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1185869551 X:3652404-3652426 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186192608 X:7080905-7080927 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186430031 X:9497395-9497417 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186467986 X:9799177-9799199 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1186783631 X:12939104-12939126 TTTCTCCCCAAAAGGGAGTCTGG + Intergenic
1187053128 X:15713967-15713989 TCCTTTCCAAAGATGGATTCAGG - Intronic
1187197442 X:17101063-17101085 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1187706828 X:22017610-22017632 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1187902385 X:24036861-24036883 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1188011134 X:25057329-25057351 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1188150574 X:26669769-26669791 TTTTTTCCCAAGATGTGTTGGGG + Intergenic
1189068504 X:37837549-37837571 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1189074065 X:37897469-37897491 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1189305958 X:39986813-39986835 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1190104082 X:47546169-47546191 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1190234218 X:48603634-48603656 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1190558764 X:51666704-51666726 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1190848366 X:54215103-54215125 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1191616957 X:63180247-63180269 TTTTTTTCCAAAAGGGAGTCTGG + Intergenic
1191619340 X:63198676-63198698 TTTTTTTCCAAAAGGGAGTCTGG - Intergenic
1192041409 X:67626452-67626474 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1192106120 X:68319086-68319108 TTTCTTCCTAAGATGCAGTATGG - Intronic
1192121223 X:68457999-68458021 TTTTTTTTTAAGATGAAGTCTGG + Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1192322987 X:70107308-70107330 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192705753 X:73527659-73527681 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192807922 X:74526067-74526089 TCTTTTACCAAGATTGAGTGAGG + Intronic
1192893111 X:75411218-75411240 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1194715822 X:97286050-97286072 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1194802186 X:98287716-98287738 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1194900389 X:99502639-99502661 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1195088240 X:101433955-101433977 TTTTTTTCCGAGATGGGGTCTGG + Intronic
1195267511 X:103196941-103196963 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1195492815 X:105492366-105492388 TTTTTTCCTAGGATAGAGTTTGG - Intronic
1195582746 X:106527091-106527113 TTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1195689410 X:107611659-107611681 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1196436764 X:115681676-115681698 TTTTTTCTTGAGATGGGGTCTGG - Intergenic
1196513983 X:116547952-116547974 TTTTTTTTCAAGATGGAGTCTGG + Intergenic
1196602695 X:117620652-117620674 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1196646045 X:118117851-118117873 TATTTTCCCAAGGAGGAGTCTGG - Intergenic
1196731283 X:118943778-118943800 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1196836616 X:119819854-119819876 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1196869963 X:120103369-120103391 TTTCTCCCCAAAATGGAGTCTGG - Intergenic
1197707448 X:129644571-129644593 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198105307 X:133455990-133456012 TTTTTCCTTGAGATGGAGTCTGG + Intergenic
1198307608 X:135398591-135398613 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198452878 X:136785232-136785254 TTTTTTCTTGAGATGGAGTCTGG - Intergenic
1198920282 X:141718079-141718101 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG + Intergenic
1198954925 X:142118464-142118486 TTTTTTTTAAAGATGGGGTCTGG + Intergenic
1198974013 X:142314665-142314687 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1199057910 X:143319344-143319366 TTCTTTCGCAAGTGGGAGTCAGG - Intergenic
1199146901 X:144379531-144379553 TTTTTTCAAAACATGGAGTTTGG - Intergenic
1199410742 X:147519533-147519555 TTTTTTTCGGAGATGGAGTCTGG + Intergenic
1199556260 X:149112613-149112635 TAATCTCCCAAGATGGAATCAGG + Intergenic
1199770823 X:150974144-150974166 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1199862583 X:151815176-151815198 CTTTTTCCCAAGAACCAGTCAGG - Intergenic
1199969365 X:152847872-152847894 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1200380349 X:155830810-155830832 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1200806343 Y:7437150-7437172 TTGTTTTTCGAGATGGAGTCTGG - Intergenic
1200822742 Y:7604537-7604559 TTTTTTTTTAAGACGGAGTCTGG - Intergenic
1201263068 Y:12179349-12179371 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1201267677 Y:12223929-12223951 TTGTTGCCCAGGATGGAGTGTGG - Intergenic
1201337364 Y:12895176-12895198 TTTTTTTTTAAGATGGAGTCTGG - Intergenic
1201632506 Y:16084597-16084619 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1201914166 Y:19164813-19164835 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1202012077 Y:20353634-20353656 TGTTTTTCTGAGATGGAGTCTGG + Intergenic
1202237314 Y:22726553-22726575 TTTTTTTTTAAGACGGAGTCTGG + Intergenic