ID: 1168614466

View in Genome Browser
Species Human (GRCh38)
Location 19:57826693-57826715
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 2, 1: 2, 2: 2, 3: 3, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168614466_1168614474 13 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614474 19:57826729-57826751 GGGAAGGTGCACTCCTCTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 156
1168614466_1168614477 21 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614477 19:57826737-57826759 GCACTCCTCTCCTGGGGAGATGG 0: 1
1: 0
2: 3
3: 41
4: 266
1168614466_1168614470 -7 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614470 19:57826709-57826731 CGCAGGTCTGGCCGTGCCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 138
1168614466_1168614469 -8 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614469 19:57826708-57826730 ACGCAGGTCTGGCCGTGCCTCGG 0: 1
1: 0
2: 3
3: 11
4: 99
1168614466_1168614471 -3 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614471 19:57826713-57826735 GGTCTGGCCGTGCCTCGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 117
1168614466_1168614475 14 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614475 19:57826730-57826752 GGAAGGTGCACTCCTCTCCTGGG 0: 1
1: 0
2: 2
3: 16
4: 172
1168614466_1168614476 15 Left 1168614466 19:57826693-57826715 CCGGTGTAGTGCACCACGCAGGT 0: 2
1: 2
2: 2
3: 3
4: 65
Right 1168614476 19:57826731-57826753 GAAGGTGCACTCCTCTCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168614466 Original CRISPR ACCTGCGTGGTGCACTACAC CGG (reversed) Intronic
900373354 1:2342258-2342280 TGCTGCCTGGTGCCCTACACAGG - Intronic
900407444 1:2498807-2498829 ACCCGCGTGGTGGACGACAACGG + Exonic
900560793 1:3305088-3305110 TCCGGCCTGGAGCACTACACAGG - Intronic
902606325 1:17571311-17571333 ACCTGCGGCCTCCACTACACCGG - Intronic
902896641 1:19484672-19484694 CCCTGCCTGGTGCACGACCCAGG - Intronic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
914199524 1:145472452-145472474 ACCTACGTGGTGCCCTCCAGTGG + Intergenic
914312102 1:146475818-146475840 ACCTACGTGGTGCTCTCCAGTGG + Intergenic
914478637 1:148045585-148045607 ACCTACGTGGTGCCCTCCAGTGG + Intergenic
914502249 1:148257517-148257539 ACCTACGTGGTGCTCTCCAGTGG - Intergenic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
922117535 1:222628948-222628970 CCATGAGTGGTGCACTACCCAGG - Exonic
924834538 1:247635611-247635633 ACCTGCGTGTTCCACTTCCCTGG - Intergenic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1075556490 10:123436134-123436156 ACCAGCCTGGTGGACTCCACTGG + Intergenic
1076300449 10:129421617-129421639 AGCTGCATGGTGCACTACCTGGG + Intergenic
1079557822 11:21782710-21782732 ACCTACCAGGTGCACTCCACTGG - Intergenic
1084259890 11:67969340-67969362 GCCTCCATGGTGCACCACACAGG - Intergenic
1084808748 11:71599290-71599312 GCCTCCATGGTGCACCACACAGG + Intronic
1084812884 11:71625913-71625935 CCCTGCGTGGTGCACCATAGAGG - Intergenic
1084845853 11:71899284-71899306 GCCTCCATGGTGCACCACACAGG + Intronic
1085558093 11:77443843-77443865 AGCTGCTTGGTGCCCTAGACAGG - Intronic
1086293475 11:85337701-85337723 TCCTTCCTGGTGCTCTACACTGG + Intronic
1089209476 11:116790675-116790697 AGCCGCGTGGTGCACCACACCGG - Exonic
1103558488 12:121779835-121779857 ACCTGCGGGCTGCACTGCCCTGG - Exonic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1119073462 14:71611141-71611163 ATCTGAGTGGTGCACTTCCCAGG + Intronic
1119912590 14:78363606-78363628 ACCTGAGTGGAGCACTGCAATGG - Intronic
1120843948 14:89110357-89110379 ACCTGCGAGGTGCACCACGGGGG - Intergenic
1133031538 16:3013519-3013541 TCCTGCGTGGTGCAGAGCACGGG + Exonic
1133032062 16:3015843-3015865 TCCTGCGTGGTGCAGAGCACCGG - Exonic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1147633230 17:41946154-41946176 ACCTTCGGGGGGCACTCCACTGG - Intronic
1149856211 17:60085179-60085201 ACCTGCGTCGAGCTCTGCACAGG - Intergenic
1151564549 17:74890485-74890507 ACCTGCCTGGTGGACTGCAGTGG - Intronic
1154322631 18:13367418-13367440 AACTGCGTGGGGCACTCCATGGG + Intronic
1164973993 19:32557729-32557751 ACTTGAATGGTTCACTACACAGG - Intergenic
1166893750 19:46010317-46010339 ACCTGTCTGGTTCACTGCACAGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
935266775 2:101401726-101401748 ACCTGCGTCCTGCACTCCTCAGG + Intronic
948151758 2:235750001-235750023 ACCTGCGTGGTGCACAGAAGGGG + Intronic
948563326 2:238868096-238868118 ACCTTTGTGGGGCACTGCACTGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1179524534 21:41967182-41967204 TCCTGCATGGTGCCCAACACAGG + Intergenic
961276362 3:125730368-125730390 GCCTCCATGGTGCACCACACAGG + Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
966881525 3:184353699-184353721 ACCTGCGTTTGGCACTGCACAGG - Exonic
969023131 4:4151588-4151610 GCCTCCATGGTGCACCACACAGG - Intergenic
969735541 4:8987317-8987339 GCCTCCATGGTGCACCACACAGG + Intergenic
969786847 4:9465124-9465146 GCCTCCATGGTGCACCACACAGG + Intergenic
969790278 4:9489603-9489625 GCCTCCATGGTGCACCACACAGG + Intergenic
981612645 4:146611746-146611768 ACATGCATGGTTCACTACTCTGG + Intergenic
981670321 4:147279373-147279395 ACCTTGGTGGTGCAAGACACAGG - Intergenic
986000638 5:3628178-3628200 CCCTGCGTGGAGCCCTGCACAGG - Intergenic
987701478 5:21405346-21405368 ACCTGCCAGGTGCACTCCACTGG + Intergenic
994184602 5:96804270-96804292 TCCTGAGTGGCTCACTACACGGG + Intronic
1004691931 6:17999488-17999510 ACCTGCTCTGTGCACGACACTGG + Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1016720347 6:147289008-147289030 ACCTTCGGGGGGCACTCCACTGG - Intronic
1019444371 7:1063581-1063603 CCCTGCGTGGGGCACTCCTCGGG + Intronic
1020310182 7:6861312-6861334 GCCTCCATGGTGCACCACACAGG - Intergenic
1026858449 7:73769874-73769896 AACTGCGTGGTGCAGAGCACCGG - Exonic
1026867241 7:73831358-73831380 AACTGCGTGGTGCAGAGCACCGG + Exonic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1029076932 7:97942109-97942131 GCCTCCATGGTGCACCACACAGG - Intergenic
1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG + Intronic
1043515024 8:80988129-80988151 TCCTGCCTGGTGACCTACACAGG + Intronic
1045681629 8:104666911-104666933 ACCTTCCGGGTGCACTCCACTGG - Intronic
1046404868 8:113760254-113760276 ATCTGTGTGGTGCTCTACAGAGG + Intergenic
1058040332 9:100295306-100295328 ACCTGCGTAGGTAACTACACAGG + Intronic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1191839792 X:65503493-65503515 ACCTGCATGGTGCAGTGCAAAGG - Exonic