ID: 1168614958

View in Genome Browser
Species Human (GRCh38)
Location 19:57830152-57830174
Sequence ATGTAGTTCCCTAGGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168614958_1168614966 23 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614966 19:57830198-57830220 TGACAGAGTGGAAGAGCCATGGG 0: 1
1: 0
2: 2
3: 19
4: 259
1168614958_1168614963 11 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614963 19:57830186-57830208 CTCCGCATGGAATGACAGAGTGG 0: 1
1: 0
2: 2
3: 14
4: 92
1168614958_1168614965 22 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614965 19:57830197-57830219 ATGACAGAGTGGAAGAGCCATGG 0: 1
1: 0
2: 5
3: 37
4: 347
1168614958_1168614967 24 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614967 19:57830199-57830221 GACAGAGTGGAAGAGCCATGGGG 0: 1
1: 1
2: 1
3: 34
4: 400
1168614958_1168614968 25 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614968 19:57830200-57830222 ACAGAGTGGAAGAGCCATGGGGG 0: 1
1: 1
2: 1
3: 45
4: 375
1168614958_1168614960 -2 Left 1168614958 19:57830152-57830174 CCTTGTTACCTAGGGAACTACAT 0: 1
1: 1
2: 0
3: 9
4: 92
Right 1168614960 19:57830173-57830195 ATTACCCAGAAAACTCCGCATGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168614958 Original CRISPR ATGTAGTTCCCTAGGTAACA AGG (reversed) Intronic
903986580 1:27233810-27233832 AGGAAGTTCCCAAGGTGACAAGG - Intergenic
905351984 1:37353657-37353679 ATGTATTTCCAAATGTAACATGG + Intergenic
906914323 1:49992467-49992489 ATTTAGTTCCCTATGTATCTGGG + Intronic
910294190 1:85628115-85628137 CTGAAGTGCCCTAGGTACCAGGG + Intergenic
912572398 1:110634133-110634155 ATGCATTTCCCAAGGTCACATGG - Intergenic
913241648 1:116835187-116835209 AGGAAGTTCCCTAGGGACCAAGG + Intergenic
1069262349 10:66414608-66414630 CTGTAGTTGCTTAGGTCACAAGG - Intronic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1072834390 10:98695592-98695614 ATGTACTTCTCTAGGCAATAGGG - Intronic
1073625842 10:105095929-105095951 ATGTAGTTCCCAGAGTAAGATGG + Intronic
1075445675 10:122511049-122511071 ATATCGTTCCCAAGGTCACAAGG - Intronic
1080172014 11:29315857-29315879 CTGTAGTTTCCAAGGAAACAGGG - Intergenic
1084540218 11:69781932-69781954 AGGTGGGTCCTTAGGTAACATGG - Intergenic
1090234467 11:125137175-125137197 ACATAATTCACTAGGTAACATGG - Intergenic
1094485862 12:30925993-30926015 ATCTATTTCCCAAAGTAACAAGG - Intergenic
1095823611 12:46508096-46508118 ATGTAGTCCTCTAGGTATCAGGG + Intergenic
1096947191 12:55420096-55420118 ATGTATTTCCCGGGGAAACATGG + Intergenic
1098094468 12:66939724-66939746 ATGGAGTTCTCTAGGTATCAAGG + Intergenic
1099213104 12:79818128-79818150 AAGTAGTGCCCTAGGTACTAGGG + Intronic
1099759762 12:86903616-86903638 CTGTGGTACACTAGGTAACAAGG + Intergenic
1101519987 12:105473360-105473382 ATGAAGTTCCCAACATAACAAGG - Intergenic
1101538819 12:105645705-105645727 ATGTTGTTCCCAAGGCAAGAGGG + Intergenic
1101866088 12:108520616-108520638 ATGTAGTGCTCTATGTAATATGG + Exonic
1103162869 12:118744606-118744628 ACGTAGTTCCCTAAGTCACTTGG - Intergenic
1103464567 12:121131984-121132006 ATGTTGCTTCCTAGGAAACAGGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105941803 13:25154255-25154277 ATGTAATTACCCAGGTAGCAAGG + Intergenic
1106882554 13:34148022-34148044 AGGTAGTTTCCTAGGATACAAGG - Intergenic
1115146484 14:30232251-30232273 ATTTAGTTCCCTAAGTAGCGTGG - Intergenic
1127782074 15:62325823-62325845 TTATACTTCCCTAGGCAACAGGG + Intergenic
1129977896 15:79837862-79837884 CTGTTGTTTCCTAGGTGACAGGG + Intronic
1129985544 15:79917083-79917105 ATGTAGATGCCTAGCTAAAATGG - Intronic
1131598322 15:93822198-93822220 GAGTAGTTGCCTATGTAACAGGG - Intergenic
1131910925 15:97200266-97200288 AAGTAGTTCCCTGTGTAACTTGG + Intergenic
1138133933 16:54505053-54505075 CTGTAATTCCATAGGTTACAGGG + Intergenic
1144433349 17:15216378-15216400 ATCAAGTTCCATAGGCAACACGG + Intergenic
1148379912 17:47188952-47188974 ATGTAGGGCCAGAGGTAACACGG + Intronic
1150709149 17:67515152-67515174 ATCTAGTCACCCAGGTAACAGGG - Intronic
1152467093 17:80472667-80472689 AGCTAGTTCCATAGCTAACAGGG + Intronic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1153907281 18:9673377-9673399 ATGCAGTTCTCTAGCTACCAGGG + Intergenic
1156723994 18:40105471-40105493 ATGTAGTTCCTTAAGTGAAAGGG + Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1157732373 18:50015247-50015269 ATGAAGTTCACTAGGTCAGAGGG - Intronic
1161919762 19:7257354-7257376 ATGATGTTCTCTAGATAACAGGG - Intronic
1164461891 19:28456137-28456159 AATTAGTTCCCTAGGCATCAAGG - Intergenic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1168612878 19:57815025-57815047 ATGTAGTTTCCCAGGTTCCAAGG + Intronic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
1168622304 19:57889157-57889179 ATGTAGTTCCCTAGGCAACAAGG + Intronic
1168628219 19:57935495-57935517 ATGTAGTTCCCCAGGTTCCAAGG + Intergenic
928441041 2:31292368-31292390 ATGAAGTCCCCAAGGTCACATGG + Intergenic
937271104 2:120653555-120653577 AAGAACTTCCTTAGGTAACATGG - Intergenic
939456694 2:142446291-142446313 CTGTAGTTCCCTTGATAAAAGGG - Intergenic
941050781 2:160731263-160731285 ATGTACTGCACTAGGTACCATGG + Intergenic
943489401 2:188531677-188531699 ATGTAGTTTGCTGGGAAACAAGG + Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1183062685 22:35345680-35345702 AGGCAGTGCCCTAGGTGACAAGG - Intronic
955016018 3:55070139-55070161 CTGTAGTTTCCAAGGCAACAGGG - Intronic
957799311 3:85054449-85054471 ATTTAATTCCATAGGTGACAAGG + Intronic
962473046 3:135730975-135730997 ATGTACTTCCCAGGGAAACATGG + Intergenic
964227276 3:154419815-154419837 ATGTGTTTCCCTAGCTAAGAGGG - Intronic
965197089 3:165614243-165614265 ATATAGTTTCCTAGGGAAAATGG + Intergenic
966019320 3:175188519-175188541 ATGTAGTTTCCTATGTCCCAGGG + Intronic
971367608 4:25989988-25990010 TTGTAGTTCCCTAGGATATAAGG + Intergenic
971990734 4:33889905-33889927 ATGAAATTCTCTGGGTAACATGG + Intergenic
974376995 4:61091226-61091248 ATGTAGATCCCTAGGTACTCTGG - Intergenic
976456056 4:85247751-85247773 ATGTTGTTCCCTAGGATTCAAGG - Intergenic
979862593 4:125712918-125712940 ATGTATTTACCTTGGTAAAATGG - Intergenic
980806771 4:137825655-137825677 ATGGCTTTCCCTAGGTAACAGGG - Intergenic
980999974 4:139819412-139819434 ATTTTGTTCCATAGGTAGCATGG + Intronic
987429019 5:17808840-17808862 AAATGGTTGCCTAGGTAACAAGG - Intergenic
987628906 5:20442155-20442177 ATGCAGTACCCCTGGTAACACGG + Intronic
990320742 5:54627778-54627800 ATGTAGTCCCCTAGGGAGCATGG - Intergenic
991187902 5:63831963-63831985 AAGTATTTCACTAGGTACCATGG - Intergenic
992556179 5:77905890-77905912 ATGTTTTTTCCTAAGTAACATGG + Intergenic
998912947 5:146980591-146980613 ATCTAGTTCCACAGGGAACAGGG - Intronic
999774501 5:154801441-154801463 ATTGAGCTCCCTAAGTAACAGGG + Intronic
1000409863 5:160927053-160927075 ATGTTGTTCCCTCTGTAAAATGG - Intergenic
1000719332 5:164687158-164687180 TTCCAGTTCCCTAGGTAATATGG + Intergenic
1001908122 5:175490027-175490049 TTGTAGTTTCCAAGGAAACAGGG - Intronic
1002770245 6:284216-284238 AGGTAGCTCTCCAGGTAACAGGG - Intergenic
1005591339 6:27331480-27331502 GTGTAGTTCCCTATGTACCAGGG - Intergenic
1010463133 6:76135804-76135826 ATGCTTTTCCCTAGATAACAGGG - Intergenic
1012021374 6:93925224-93925246 ATGTAGTTAAATAGGTTACAGGG + Intergenic
1017210459 6:151849961-151849983 ATATAATTCCCTAGGAAACTAGG - Intronic
1020119710 7:5496130-5496152 ATGAACTTGCCTAGGTCACATGG - Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1027994738 7:85411339-85411361 ATGAAGTTCTCAAGGTTACATGG - Intergenic
1029001081 7:97155002-97155024 ATGTATTGCCACAGGTAACAAGG - Intronic
1030560867 7:111084259-111084281 CTGTAATTCTCTAGGTAACGAGG + Intronic
1035295564 7:157865171-157865193 ATGGAGGTCCCTAGGTGAGACGG + Intronic
1035978544 8:4341114-4341136 ACATCGTTGCCTAGGTAACAAGG + Intronic
1037526158 8:19726070-19726092 ATGACTTTCCCTAGGTAATATGG - Intronic
1038205253 8:25458993-25459015 AAGTAGTCCCCGAGGTCACAAGG + Exonic
1052158334 9:25223965-25223987 TTGTAGCTCTCAAGGTAACATGG - Intergenic
1055633329 9:78247409-78247431 ATGTAGTTACATAGGTGGCAGGG + Intronic
1062299144 9:135854808-135854830 ATGAGGTTACCTATGTAACAAGG - Intronic
1195156502 X:102128363-102128385 CTGAAGTTCTCAAGGTAACAAGG + Intergenic
1196738265 X:118999967-118999989 ATGTAGTTCCCTTTCCAACAGGG + Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1200343189 X:155421699-155421721 TGGTAGTTCTCTAGGAAACAAGG + Intergenic
1202050211 Y:20772983-20773005 ATGTAATTCCCTTGGTAACCAGG - Intronic