ID: 1168616972

View in Genome Browser
Species Human (GRCh38)
Location 19:57846050-57846072
Sequence GACTCTGATGATGGTTTCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 2, 2: 19, 3: 128, 4: 595}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168616972_1168616976 21 Left 1168616972 19:57846050-57846072 CCCGTGAAACCATCATCAGAGTC 0: 1
1: 2
2: 19
3: 128
4: 595
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168616972 Original CRISPR GACTCTGATGATGGTTTCAC GGG (reversed) Exonic
900509099 1:3050005-3050027 GCCTCTGATGAGGGTGTCACAGG - Intergenic
901452707 1:9345624-9345646 GACTATCATGCTGGTTTCCCAGG + Intronic
902035891 1:13457762-13457784 GACTGTGGTGATGATTTCATAGG + Intergenic
902194571 1:14788882-14788904 GATTCTGATGGTGGTGTCTCAGG - Intronic
902673050 1:17988422-17988444 GATTGTGGTGATGGTTTTACAGG - Intergenic
903124719 1:21239841-21239863 GACTGTGGTGATGGTTACATGGG + Intronic
903620996 1:24698232-24698254 CATTGTGTTGATGGTTTCACTGG - Intergenic
904156344 1:28486405-28486427 AATTGTGATGATGATTTCACAGG + Intronic
904298056 1:29536134-29536156 GATTGTGGTGATGGTTTCACAGG + Intergenic
905573287 1:39023519-39023541 GACTCTGGTGAAGCTTTCCCAGG - Intergenic
905724304 1:40236167-40236189 GATTCTGATGATGATTTAAGTGG + Exonic
905970542 1:42138616-42138638 GATTGTGGTGATGGTTTCACAGG - Intergenic
906540289 1:46580413-46580435 GACTCTGAAGCTGTATTCACTGG - Intronic
906880168 1:49581517-49581539 GACTATGATGATGGTTGAATGGG + Intronic
908231488 1:62109804-62109826 GAATGTGGTGATGGCTTCACAGG + Intronic
908344413 1:63217156-63217178 GATTGTAGTGATGGTTTCACAGG + Intergenic
908372572 1:63497821-63497843 GACTCTGATGACTTTATCACTGG + Intronic
908445944 1:64200185-64200207 GATCCTGTTGATGTTTTCACAGG + Intergenic
909328639 1:74385303-74385325 GATTGAGATGGTGGTTTCACAGG + Intronic
909442221 1:75710155-75710177 GATTGTGGTGATGGTTTCACAGG + Intergenic
909596075 1:77407566-77407588 TATTTTTATGATGGTTTCACGGG + Intronic
909744064 1:79070973-79070995 GATTGTGGTGATGGTTTCTCAGG + Intergenic
910211660 1:84799914-84799936 GATTGTGATGATGGTATTACAGG + Intergenic
910243308 1:85111863-85111885 GATTATGTTGATGGTTTCATGGG - Intronic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
910421397 1:87067526-87067548 CACTCTGATGATAGTTTCTTTGG + Intronic
911564355 1:99444869-99444891 CACTCTGATGATAGTTTCTTTGG + Intergenic
911564501 1:99447442-99447464 GACTGTGATGATGGTTTCCCGGG + Intergenic
911826714 1:102495872-102495894 GACAATGGTGATGGTTTCACAGG + Intergenic
911864881 1:103005891-103005913 GATGATGATGATGGTTTTACAGG - Exonic
912138048 1:106685345-106685367 GAGTGTGATGATGGTATCATAGG - Intergenic
912304310 1:108550143-108550165 GAATTTGATGATGATTTCAAAGG - Intergenic
912660189 1:111520923-111520945 GACTGTGGTGATGGTTTCACAGG - Intronic
913035766 1:114964331-114964353 CACTCTGATGATAGTTTCTTTGG + Intronic
913041150 1:115025273-115025295 GATTGTGATGATGGTTTTACAGG - Intergenic
913549155 1:119899724-119899746 GATAATGGTGATGGTTTCACAGG + Intergenic
913578474 1:120201272-120201294 GATTGTGGTGATGATTTCACAGG - Intergenic
913629698 1:120697079-120697101 GATTGTGGTGATGATTTCACAGG + Intergenic
914560397 1:148812712-148812734 GATTGTGGTGATGATTTCACAGG - Intronic
914612436 1:149317503-149317525 GATTGTGGTGATGATTTCACAGG + Intergenic
915181943 1:154069229-154069251 CACTCTGATGGTAGTTTCTCTGG - Intronic
915447474 1:155982150-155982172 GAATATGATGATGATTTCCCTGG + Intronic
916222549 1:162459409-162459431 GTTCCTAATGATGGTTTCACAGG + Intergenic
916251628 1:162743784-162743806 GATTATGGTGATGATTTCACAGG - Intronic
916559349 1:165919895-165919917 GATTTTGGTGATGGTTTCAGAGG - Intergenic
916815422 1:168347137-168347159 GATGGTGATGATGGTTTCATGGG + Intergenic
916874520 1:168954651-168954673 CACTCTGATGATAGTTTCTTTGG + Intergenic
917137989 1:171806265-171806287 GATTCTGGTGATGGTTTCATGGG - Intronic
918432412 1:184475568-184475590 AGCTCTGATTGTGGTTTCACAGG - Intronic
918794209 1:188872337-188872359 GATTGTGGTGATGGTTTCAATGG - Intergenic
918844293 1:189588774-189588796 GATTGTGTTGATGGTTTCACAGG + Intergenic
919133511 1:193480285-193480307 GATTGTGGTGATGGTTTCATGGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
919602962 1:199645636-199645658 AATTGTCATGATGGTTTCACAGG + Intergenic
921001239 1:211045602-211045624 GATTGTGGTGATGGTTTCCCAGG - Intronic
921546443 1:216480607-216480629 CACTCTGTTGATTGTTTCATTGG - Intergenic
921888019 1:220325765-220325787 GACTCAGATGACTGTTTCCCTGG - Intergenic
922118823 1:222642190-222642212 GGTTGTGATGATGGTTTCACAGG + Intronic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922386944 1:225095908-225095930 GATTGTGGTGATGATTTCACAGG + Intronic
923037276 1:230293123-230293145 GAATCAGATGATGGCCTCACAGG + Intergenic
1062796643 10:349581-349603 GACTGTCATGTTGGTTGCACAGG - Intronic
1063413026 10:5851355-5851377 GATTTTGGTGATGGTTTCACGGG - Intergenic
1063946691 10:11183047-11183069 GATTGTTGTGATGGTTTCACAGG - Intronic
1063952844 10:11240473-11240495 GACTCTGAGGTTTCTTTCACAGG - Intronic
1064201257 10:13286916-13286938 GATTGTGGTGATGATTTCACAGG + Intronic
1064272598 10:13879026-13879048 GATTGTGGTGATGGTTTCCCAGG + Intronic
1064778829 10:18810657-18810679 GATTGTGGTGATGGTTTCACAGG - Intergenic
1065338079 10:24675487-24675509 GACTGTGGTGATGTTTTCACTGG + Intronic
1067195493 10:44114427-44114449 GACAGTGATCATGGGTTCACTGG - Intergenic
1068193353 10:53683567-53683589 GACTGTGGTGATGGTATCATCGG - Intergenic
1069093201 10:64227240-64227262 CACTCTGATGATAGTTTCTTTGG + Intergenic
1069716919 10:70526997-70527019 GATTATGATGATGGTTTTCCTGG - Intronic
1070083975 10:73216871-73216893 GATTGTGGTGATGGTTTCATGGG - Intronic
1070701731 10:78607134-78607156 CACTCTGATGGTGGTTTCTTTGG + Intergenic
1071664063 10:87536489-87536511 GATTATGGTGATGGTTTCATGGG - Intronic
1071812779 10:89201241-89201263 GATTGTGGGGATGGTTTCACAGG - Intergenic
1071814773 10:89221126-89221148 GATTATGGTGATGGTTTCACAGG + Intronic
1071817678 10:89249808-89249830 GAATGTACTGATGGTTTCACAGG + Intronic
1071818826 10:89259960-89259982 CACTGTAGTGATGGTTTCACAGG + Intronic
1073589737 10:104745485-104745507 GATTATGGTGATGGTTTCAAGGG - Intronic
1073831701 10:107391752-107391774 GATTTTGGTGATGGTATCACAGG - Intergenic
1073862140 10:107758564-107758586 GATTGTGGTGATGGTTTCACAGG - Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074159552 10:110826321-110826343 GATTGTGGTGATGGTCTCACAGG - Intronic
1074797897 10:116967515-116967537 GATGGTGGTGATGGTTTCACAGG - Intronic
1075231934 10:120687918-120687940 AACTTTGATGCTGTTTTCACAGG + Intergenic
1076287979 10:129319832-129319854 GACTGTGGTGATGAATTCACAGG + Intergenic
1076437838 10:130458905-130458927 GACTGGGAGGATGGTTTCACAGG + Intergenic
1076805059 10:132851461-132851483 GAAGGTGGTGATGGTTTCACGGG - Intronic
1076938851 10:133586805-133586827 GATTGTGGTGATGGCTTCACTGG - Intergenic
1077651202 11:3974255-3974277 GACTTTAATGATGTTTTCAGCGG + Intronic
1077987591 11:7369436-7369458 CACTCTGATGATAGTTTCTTTGG + Intronic
1078026442 11:7700226-7700248 GACTCTGCTGATGCTGTCTCTGG + Intronic
1078144554 11:8713997-8714019 GACTCTGATGACAGGTTCAAAGG - Exonic
1078371911 11:10754492-10754514 GATTGTGGTGATGGTTTCACAGG - Intronic
1078636983 11:13060818-13060840 TATTTTGATGATGGTTTCCCAGG + Intergenic
1079192492 11:18291958-18291980 GTCTCTGAGAATGGTTTTACAGG - Exonic
1079461447 11:20682655-20682677 GATTGTGATGATGGCTGCACAGG - Intronic
1079530695 11:21448639-21448661 GATTGTGCTGATGGTTTCATGGG - Intronic
1079688880 11:23397814-23397836 GATTGTGGTGATGGTATCACAGG + Intergenic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1082674226 11:56075920-56075942 TACTCTGATGATAGTTTCTTTGG + Intergenic
1082886170 11:58085307-58085329 GATTGTGGTGATGGTCTCACAGG - Intronic
1082985720 11:59169346-59169368 GACTCTGGTGAAGCTTTCCCAGG + Intergenic
1083560300 11:63668275-63668297 GCCTGTGATGATGTTTTCTCTGG - Intronic
1084918058 11:72445917-72445939 GATTGTGGTGATGGTTTCAGAGG + Intergenic
1086207624 11:84278999-84279021 TACTCTGATGCTAGTTTCATAGG - Intronic
1086253261 11:84843183-84843205 GATTATGGTGATGGTTTCACAGG + Intronic
1086667913 11:89507232-89507254 GATTGTGGTGATGGTTTCATGGG + Intergenic
1087378743 11:97377716-97377738 CACTCTGATGATAGTTTCTTTGG + Intergenic
1087437064 11:98134558-98134580 AACTATGATGATTGTTTCATGGG - Intergenic
1087551839 11:99660403-99660425 TATTGTGGTGATGGTTTCACAGG + Intronic
1087588603 11:100154978-100155000 CACTCTGATGATAGTTTCTTTGG + Intronic
1087807245 11:102568589-102568611 GCCTCTGAAGCTGCTTTCACGGG + Intergenic
1087888255 11:103505636-103505658 CACTCTGATGATAGTTTCTTTGG - Intergenic
1088133051 11:106519243-106519265 GATTGTGATGATGGTTTCATGGG + Intergenic
1088398622 11:109397772-109397794 GATTATGGTGATGGTTTCATGGG + Intergenic
1088517399 11:110653255-110653277 CACTCTGATTATGGTTTCTTTGG - Intronic
1088563230 11:111136981-111137003 GCTTGTGGTGATGGTTTCACAGG - Intergenic
1090177784 11:124666579-124666601 GATACTGATGATAATTTCACAGG - Intronic
1091555744 12:1572315-1572337 GACTGTGGTGCTGGTTTCATGGG - Intronic
1092705511 12:11279844-11279866 GACTCTGCTGAAGCTTTCCCAGG + Intergenic
1092714371 12:11373327-11373349 GACTCTGCTGAAGCTTTCCCAGG + Intronic
1092868952 12:12788308-12788330 GACTTAGATGACGGCTTCACGGG - Exonic
1094123745 12:27000794-27000816 GATTGTGGTAATGGTTTCACAGG - Intronic
1094439177 12:30456225-30456247 GACAGTGGTGATGGTTTCATAGG - Intergenic
1095149395 12:38773389-38773411 GATTGTGGTGATGGTTTCATGGG + Intronic
1095160416 12:38907414-38907436 GATTTTGGTGATGGCTTCACAGG - Intronic
1095263226 12:40122520-40122542 GATAGTAATGATGGTTTCACAGG + Intergenic
1095302451 12:40600641-40600663 TACTCTGTTGATGGTTTCCTTGG + Intergenic
1095434754 12:42175442-42175464 GATTGTGGTGATAGTTTCACAGG + Intronic
1095664876 12:44786061-44786083 CACTCTGATGATAGTTTCTTTGG - Intronic
1095755779 12:45765755-45765777 GACTGTGTTAATAGTTTCACAGG - Intronic
1096231116 12:49897440-49897462 GAGTCTGATCATGGGTTCCCCGG + Intronic
1096391443 12:51232236-51232258 GATTGTGGTGATGGTTTCATGGG - Intergenic
1096527705 12:52221957-52221979 CACTCAGCTGATGGTTTCAGGGG + Intergenic
1096972639 12:55680165-55680187 GACTGTGGTAATGGTTTCCCAGG + Intergenic
1097024988 12:56048299-56048321 GAGTATGGTGATGGTTTCATGGG - Intergenic
1097204696 12:57310705-57310727 GATTGGGGTGATGGTTTCACAGG - Intronic
1098066946 12:66628506-66628528 AACTCTGATGAGGGGTTAACAGG - Intronic
1099036822 12:77598653-77598675 GATTCTGGTAATGGTTTCCCGGG - Intergenic
1099090407 12:78299733-78299755 GACTGTAGTGATGGTATCACAGG + Intergenic
1099653742 12:85462358-85462380 GACTGTGGTGATGGTTTCATGGG + Intergenic
1100523776 12:95401301-95401323 GATTGTGGTGATGGTTTCATGGG - Intergenic
1100894679 12:99168114-99168136 GATTGTGGTGATGGTTTCACAGG + Intronic
1100995789 12:100299428-100299450 GATCGTGGTGATGGTTTCACAGG - Intronic
1101626743 12:106451202-106451224 GACTATAGTGGTGGTTTCACAGG + Intronic
1102359087 12:112268210-112268232 GATTGTGGTGATGGTTTCATTGG - Intronic
1102906610 12:116680995-116681017 GATTGTGGTGGTGGTTTCACAGG + Intergenic
1103438602 12:120946520-120946542 GATCATGGTGATGGTTTCACAGG - Intergenic
1104792145 12:131490051-131490073 GATTGTGATGATGGTTACATGGG + Intergenic
1104831316 12:131753813-131753835 GGCTCTGCCGATGGCTTCACAGG - Intronic
1105617601 13:22033649-22033671 GATTATGATGATGGTTACATGGG - Intergenic
1106214885 13:27687842-27687864 GATTATGGTGATGGTTTCACAGG + Intergenic
1107681044 13:42850969-42850991 GATTGTGGTGATGGTTTCATGGG - Intergenic
1107767404 13:43751448-43751470 GATTGTGATGATGGTTTCACAGG - Intronic
1107970377 13:45636118-45636140 CACTCTGATGATAGTTTCTTTGG + Intergenic
1108132538 13:47318273-47318295 GAATGTGGTGATGGTTTCACAGG - Intergenic
1108334973 13:49431089-49431111 TGATGTGATGATGGTTTCACAGG - Intronic
1109069493 13:57746723-57746745 GACTGTGAGGATGTTTTCAGAGG + Intergenic
1109487075 13:63039652-63039674 GATTGTGCCGATGGTTTCACAGG - Intergenic
1109796321 13:67317906-67317928 CACTCTGATGATAGTTTCTTTGG + Intergenic
1110024445 13:70517388-70517410 CATTGTGATGATGATTTCACAGG + Intergenic
1110514404 13:76392786-76392808 GATTGTTATGATGGTTTCATGGG + Intergenic
1110745146 13:79043642-79043664 GATTGTGGTGATGGTTTCACTGG + Intergenic
1110762842 13:79249744-79249766 GATTGTGGTGATGGTTTCATGGG + Intergenic
1110802843 13:79720068-79720090 AATTATGATGCTGGTTTCACAGG - Intergenic
1111247568 13:85560743-85560765 GATTGTGATGATGATTTCACAGG - Intergenic
1111928913 13:94493480-94493502 GAGTGTGATGATGGTTTCACTGG + Intergenic
1111981242 13:95017679-95017701 GAATGTGGTGATGGTTTCATAGG + Intergenic
1112013308 13:95310138-95310160 GACTCTGGTGAAGCTTTCCCAGG - Intergenic
1112542306 13:100327142-100327164 GGCTGTGGTAATGGTTTCACAGG - Intronic
1112731842 13:102371487-102371509 TAGTCTGATGGAGGTTTCACTGG - Intronic
1112949984 13:104982157-104982179 GAGTCTGATTTTGGTTTGACTGG + Intergenic
1113915191 13:113866427-113866449 GATTGTGATGATGGCTTCACAGG - Intergenic
1114703447 14:24702562-24702584 GATTATTGTGATGGTTTCACAGG - Intergenic
1115307674 14:31949232-31949254 AACTCTGACGATGGTTACATAGG - Intronic
1115804858 14:37039334-37039356 AATTGTGATGATGTTTTCACAGG - Intronic
1116245610 14:42407791-42407813 GACTCTGCTGATATTTTCAGTGG + Intergenic
1116375172 14:44190268-44190290 GATTATGGTGATGGTATCACAGG + Intergenic
1116400645 14:44502573-44502595 CATTGTGGTGATGGTTTCACAGG + Intergenic
1117709542 14:58511049-58511071 GATTGTGGTGATGGTTTCATGGG + Intronic
1117868006 14:60169558-60169580 GATTGTGGTGATGGTTTCACAGG - Intronic
1118088613 14:62447046-62447068 TACTCTGATGATAGTTTCTTTGG + Intergenic
1118424193 14:65641090-65641112 GATTGTGGTGATGGTTTCATGGG - Intronic
1118467865 14:66047278-66047300 GACTCTGATGAAGCTTTTCCAGG + Intergenic
1119142747 14:72282681-72282703 GATTGTGATGATAGTTTCACAGG - Intronic
1119160135 14:72445578-72445600 GATTGTGATGATGTTTTCAAGGG + Intronic
1119275003 14:73347369-73347391 GATTGTGGTGATGGTTTCTCAGG - Intronic
1119834554 14:77736671-77736693 GCTTGTGATGATGATTTCACAGG - Intronic
1120033948 14:79674347-79674369 GACTGTGTTGAAGGTATCACAGG - Intronic
1120278625 14:82410564-82410586 GATGGTGGTGATGGTTTCACAGG - Intergenic
1120901905 14:89582708-89582730 GATCATGGTGATGGTTTCACAGG - Intronic
1121167703 14:91823030-91823052 GACTGTGGTGATGGTTTCATAGG + Intronic
1123921772 15:25075171-25075193 GACTCTGATGTTATGTTCACAGG + Intergenic
1124215395 15:27803996-27804018 GATTGTGGTGACGGTTTCACAGG + Intronic
1124874346 15:33577801-33577823 CACTCTGATGATAGTTTCTTTGG - Intronic
1125009884 15:34859783-34859805 GACTGTGCTGATGGCTTCACAGG + Intronic
1125079685 15:35657714-35657736 GAATCTCATGATGCTGTCACTGG + Intergenic
1125088246 15:35757696-35757718 AACTCTGAGGGTGGTTTCACAGG - Intergenic
1125526420 15:40378412-40378434 AATTGTGGTGATGGTTTCACAGG + Intergenic
1126028355 15:44471491-44471513 GATGATGGTGATGGTTTCACAGG - Intronic
1126105858 15:45146735-45146757 AAGTCTGGTGATGGTTTCATGGG - Intronic
1126145197 15:45467277-45467299 GATTGTGGTGATGGTTTCACAGG - Intergenic
1126313750 15:47345892-47345914 GATTATGGTGATGGTTTCATAGG + Intronic
1127183177 15:56447730-56447752 GATTGTGGTGATGGTTTCACAGG - Intronic
1127335023 15:57975900-57975922 AACTCTACTGATGGTTTCACAGG + Intronic
1127444867 15:59050680-59050702 GATTGTAATGATGGTTTTACAGG - Intronic
1127629688 15:60815396-60815418 GACTCTGCTGAGGGTTTAAACGG - Intronic
1128779876 15:70352286-70352308 GACCCTGATGATGAGTTCCCCGG - Intergenic
1128964414 15:72043760-72043782 GACTGTGGTGGTGGTTTCATGGG + Intronic
1129800615 15:78411061-78411083 GACTCTGATGATGGTTTCATGGG - Intergenic
1130524147 15:84689317-84689339 GATTGTGATGATGGTTTCACAGG + Intronic
1131256607 15:90867005-90867027 GATTGTGGTGATGGTTTCATGGG - Intergenic
1131794608 15:96002445-96002467 TACTGTGATGATGGTTTAAATGG - Intergenic
1133470745 16:6072884-6072906 GATTGTGGGGATGGTTTCACAGG + Intronic
1135718829 16:24796778-24796800 GTCTCTCATTATGGTCTCACTGG - Intronic
1136067122 16:27766791-27766813 GCCTCTGCTGAGGGCTTCACGGG + Intronic
1136221744 16:28833731-28833753 GAGTCTGATGAGGGGTTAACAGG + Intronic
1137552268 16:49445829-49445851 GATTTTGGTGATGGTTTCATGGG - Intergenic
1137901127 16:52270737-52270759 GATTGTGGTGATGCTTTCACAGG - Intergenic
1138846263 16:60570664-60570686 GATTGTAGTGATGGTTTCACAGG + Intergenic
1138890367 16:61135926-61135948 GAATTTGGTGATGGTTTCATGGG + Intergenic
1139668612 16:68475764-68475786 GATTGTGGTGGTGGTTTCACAGG - Intergenic
1140176010 16:72660737-72660759 GATTGTGGTGATGGTTTCATGGG + Intergenic
1140732266 16:77867263-77867285 GACGGTGATGAGGGTTTCACAGG + Intronic
1141074910 16:80995829-80995851 GACTGTGATGGTGGTTGCATGGG + Intronic
1141270224 16:82532891-82532913 GATTGTGATCATGGTTTCATGGG - Intergenic
1141299879 16:82804380-82804402 GATTGTGGTGATGGTATCACAGG + Intronic
1143749229 17:9016244-9016266 AACTCTGATGCTGGTTCCAAAGG + Intergenic
1143752532 17:9039583-9039605 GATTGTGGTGATGGTTTCACAGG - Intronic
1143927706 17:10387243-10387265 GATTGAGATGATGGTTTCACAGG - Intergenic
1144002572 17:11069384-11069406 GACTGTGGTGATGGTATCACAGG - Intergenic
1144567285 17:16370208-16370230 GATTATGGTGATAGTTTCACAGG - Intergenic
1147299567 17:39514802-39514824 GGCTGTGTTGATGGTTTTACTGG - Intronic
1147584027 17:41642682-41642704 GCCTCGGAGGATAGTTTCACAGG + Intergenic
1149957013 17:61062978-61063000 GACTCTGGTGAAGCTTTCCCGGG + Intronic
1150727042 17:67659838-67659860 GATTGTGGTGATGGTTTCACAGG - Intronic
1151022483 17:70633503-70633525 GATTGTGATGATGGTTTTACAGG - Intergenic
1152324001 17:79625070-79625092 GATGGTGGTGATGGTTTCACGGG - Intergenic
1153221923 18:2869367-2869389 GATTGTGATGTTGGTTTCACGGG - Intronic
1153607759 18:6851970-6851992 GACTGTGGTGATGGTTTCATAGG + Intronic
1153804585 18:8701485-8701507 GATTCTGAAGATTATTTCACTGG + Intergenic
1154039760 18:10842726-10842748 GATTGTGATGATGGTTTCAATGG + Intronic
1154299311 18:13179197-13179219 GATTGTGGTGATGGTTTCACTGG - Intergenic
1154299485 18:13180641-13180663 GATTATGGTGATGGTTTCACAGG - Intergenic
1155199744 18:23506278-23506300 GATTGTGGTGATGGTTTCATGGG - Intronic
1155457048 18:26028825-26028847 GATTCTGCTGATGGTTTCACAGG + Intronic
1156128540 18:33938734-33938756 CACTCTGATGATAGTTTCTTTGG + Intronic
1156206521 18:34892047-34892069 GATTGTGGTGATGGTTTCACAGG + Intergenic
1156528100 18:37787283-37787305 CACTCTGATGATAGTTTCTTTGG + Intergenic
1156569344 18:38235239-38235261 GATGATGATGATGGTTTTACTGG + Intergenic
1156612841 18:38747927-38747949 GATTAGGATGATGGTTTCAGGGG + Intergenic
1156678720 18:39563616-39563638 GACTGTGGTAATGGCTTCACAGG + Intergenic
1157019810 18:43767001-43767023 GACTCTGATGATAGTTTCTTTGG + Intergenic
1158021911 18:52853184-52853206 GAATCTCATGTTGCTTTCACAGG + Intronic
1158209357 18:55029640-55029662 GATTGTGGTGATGGTTTCATGGG + Intergenic
1158459959 18:57637619-57637641 AATTGTGGTGATGGTTTCACAGG - Intergenic
1158749029 18:60237193-60237215 GATTGTGATGATTGTTTCACAGG - Intergenic
1158961729 18:62593425-62593447 GATTGTGGTAATGGTTTCACAGG + Intergenic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1159415205 18:68138118-68138140 CACTCTGATGATGGTTTCTTTGG + Intergenic
1159825920 18:73210181-73210203 CACTCTGATGATAGTTTCTTTGG - Intronic
1159859076 18:73625779-73625801 AACTCTGATGATGATATAACCGG - Intergenic
1160132537 18:76239495-76239517 GACAGTGATGATAGTTTCACAGG + Intergenic
1160162546 18:76484881-76484903 GAATCTGTTAATGGTTTCACAGG - Intronic
1162176875 19:8836938-8836960 GTCTTTGATGATGTTTTTACTGG - Intronic
1162191717 19:8952212-8952234 GAGTCTGGTGATGGTTTCTGTGG + Exonic
1162356547 19:10188997-10189019 AAATCTGATGTGGGTTTCACCGG - Intronic
1164450549 19:28359378-28359400 GACTCTGATGGTTGTTTCCTTGG + Intergenic
1164452379 19:28377973-28377995 GATGGTGGTGATGGTTTCACAGG - Intergenic
1164980451 19:32609734-32609756 GATGGTGGTGATGGTTTCACAGG + Intronic
1165278711 19:34778045-34778067 GATTATAGTGATGGTTTCACAGG + Intergenic
1166459818 19:42977110-42977132 TATTCGGATGATGTTTTCACAGG + Intronic
1166485574 19:43208438-43208460 GGCTCAGATGATGGATTCATGGG + Intergenic
1166514306 19:43434574-43434596 GGTTGTGGTGATGGTTTCACAGG + Intergenic
1167122540 19:47527244-47527266 GACTGTGGTGATGGTTTCCCAGG + Intronic
1167136235 19:47617729-47617751 GAAGCTGGTGATGGTTACACAGG - Intronic
1168483947 19:56744896-56744918 CACTCTGATGATAGTTTCTTTGG - Intergenic
1168484005 19:56745445-56745467 CACTCTGATGATAGTTTCTTTGG - Intergenic
1168484033 19:56745689-56745711 CACTCTGACGATGGTTTCTTTGG - Intergenic
1168484041 19:56745750-56745772 CACTCTGACGATGGTTTCTTTGG - Intergenic
1168484049 19:56745811-56745833 CACTCTGATGATAGTTTCTTTGG - Intergenic
1168586026 19:57592853-57592875 GATCATGATTATGGTTTCACAGG - Exonic
1168611854 19:57807238-57807260 GACTCTGATGATGGTTTCATGGG + Exonic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
1168619865 19:57869542-57869564 GACTATGTTAATGGTTTCATGGG + Intronic
926809538 2:16744203-16744225 GATTCTGATAATGCTTTCCCTGG + Intergenic
927120896 2:19961813-19961835 GACTCTGGTGAAGTTTTCCCAGG - Intronic
927680679 2:25137121-25137143 GCTTCTGGTGCTGGTTTCACTGG + Intronic
927734034 2:25502370-25502392 GTCTTAAATGATGGTTTCACTGG - Intronic
927972241 2:27313008-27313030 GACTCTGACCATGGTGTCCCTGG - Exonic
928127048 2:28624123-28624145 GATTGTGGTGATGATTTCACAGG - Intronic
928241177 2:29587993-29588015 AACTCTGATGATGCATTCTCTGG - Intronic
928711126 2:34006831-34006853 GATTGTGGTGATGGTTTCACAGG - Intergenic
928893639 2:36235955-36235977 AACTTTGTTGATAGTTTCACTGG - Intergenic
929048508 2:37814233-37814255 GATTGTGGTGATGGTTTCATTGG + Intergenic
929188021 2:39115199-39115221 GATTGTGCTGATGGTTTCAGGGG - Intronic
929339983 2:40803269-40803291 GTTTCTGTAGATGGTTTCACAGG - Intergenic
929566193 2:42986865-42986887 GATTGTGGTGATGGTTTCAAGGG - Intergenic
929626247 2:43410786-43410808 GACAGTGATGATGGTTTTATGGG + Intronic
929909521 2:46077273-46077295 GATTGTGGTGATGGTTTCATGGG + Intronic
930081772 2:47455860-47455882 GACTTTGATGATGCTTTCCCTGG + Intronic
930313484 2:49770953-49770975 GGCCCTCATGATGGTGTCACAGG + Intergenic
930548347 2:52798970-52798992 CACTCTGATCATGGTTTCTTTGG - Intergenic
930678776 2:54233248-54233270 GATTATGGTGATAGTTTCACAGG - Intronic
930735036 2:54769652-54769674 CATTGTGGTGATGGTTTCACAGG - Intronic
931101662 2:59008858-59008880 CACTGTGGTCATGGTTTCACAGG - Intergenic
931547102 2:63401178-63401200 CACTCTGATGATAGTTTCTTTGG - Intronic
931580511 2:63766671-63766693 GATTGTGGTGATGTTTTCACAGG - Intronic
931703763 2:64929677-64929699 GATTGTGGTGATGGTTTCACTGG - Intergenic
932320516 2:70819117-70819139 GATTGTGGTGATGGTTTCAGGGG + Intronic
933017735 2:77151066-77151088 GATTGTGGTGATGATTTCACAGG - Intronic
933061936 2:77748823-77748845 GACAATGATGAAGGTTTCTCTGG + Intergenic
933476038 2:82791858-82791880 AACTGTTGTGATGGTTTCACAGG - Intergenic
933986599 2:87596944-87596966 GAGTCTGCTGATGATTACACTGG + Intergenic
934562515 2:95320574-95320596 GACTTTGAAGATGGATTCCCTGG + Intronic
934930454 2:98418154-98418176 GATTGTGGTGATGGTATCACAGG + Intergenic
934935424 2:98461781-98461803 GCCTCTTCTGACGGTTTCACTGG + Intronic
935183472 2:100710719-100710741 GACTGTGGTGATGGTTTCACAGG + Intergenic
935450711 2:103205717-103205739 CACTCTGATGATAGTTTCTTTGG - Intergenic
936307238 2:111353857-111353879 GAGTCTGCTGATGATTACACTGG - Intergenic
936471714 2:112804736-112804758 GACTGTAGTGATAGTTTCACTGG + Intergenic
936472220 2:112809469-112809491 GATTGTGGTGATGTTTTCACAGG - Intergenic
936575784 2:113653744-113653766 GAATCTGCTGATGTTTTCATTGG - Intergenic
937070605 2:119060360-119060382 GAATGTGCTGATGGTTTCATAGG - Intergenic
937192520 2:120117710-120117732 GATTATGGTGTTGGTTTCACGGG - Intronic
937313013 2:120913853-120913875 GGCCCTGGTGATGGTTTCCCAGG - Intronic
937346110 2:121126496-121126518 AACTGTGATGATGGTTCCATGGG + Intergenic
937586422 2:123557102-123557124 GATTGTGATGATAGTTTCAGGGG - Intergenic
939151711 2:138481002-138481024 GATTATGGTGATGGTTTCATGGG - Intergenic
939593201 2:144092119-144092141 GTCTGTGGTGATGGTTACACAGG + Intronic
942211473 2:173675470-173675492 CACTCTGATGATAGTTTCTTTGG - Intergenic
942283816 2:174393780-174393802 GATTGTGATGATGGTTTCACAGG - Intronic
942348126 2:175024837-175024859 GATTGTGGTGATGGTTTCACAGG - Intergenic
942589120 2:177522166-177522188 GACTGGGGTGATGGTTTCACAGG - Intronic
943139423 2:183960828-183960850 GGCTTTGCTTATGGTTTCACAGG + Intergenic
943225046 2:185162343-185162365 GATTGTGGTGATGGTTTCATGGG - Intergenic
943712457 2:191112056-191112078 GATTGTGATAATGGTTTCATGGG + Intronic
944524188 2:200601528-200601550 GACCGTGGTGATGGTTTCATGGG + Intronic
944734408 2:202548949-202548971 GACTGTGATGATGGTTTTATGGG - Intronic
945183972 2:207121046-207121068 GTCTCTGAGGAAGGTTTTACAGG + Intronic
945669181 2:212781947-212781969 GATTGTGATGTTGGTTTCATGGG - Intergenic
945887770 2:215394784-215394806 GACTCCAATGATGGATTCACAGG + Intronic
946000665 2:216479259-216479281 TATTCTGATGGTGATTTCACAGG - Intronic
946169294 2:217885034-217885056 GACCTTGATGATGCTTTCAAAGG - Exonic
946943869 2:224799081-224799103 GATTGTGGTGATGGTTTCATGGG - Intronic
947295239 2:228623701-228623723 GACTGTGGTGATAGTTTCACAGG + Intergenic
1169669713 20:8083182-8083204 GACTCTGAAGATAATTTAACTGG + Intergenic
1169802680 20:9526986-9527008 GATTGTGGTGATGGCTTCACAGG - Intronic
1170151584 20:13232235-13232257 GACTATGGTGATGGTTTTACAGG - Intronic
1170582737 20:17711277-17711299 GACTCTCATGAGGGCTTTACAGG - Intronic
1171158857 20:22903184-22903206 GTTTGTGGTGATGGTTTCACAGG - Intergenic
1171939069 20:31307105-31307127 GATTGTGATGATGGTTTCATGGG - Intronic
1172805264 20:37607366-37607388 GACTTTGCTGAAAGTTTCACTGG + Intergenic
1173343140 20:42172766-42172788 GACTGTGATGGTGGTCACACAGG - Intronic
1173635246 20:44550600-44550622 GACTCTGGTGAAGCTTTCCCAGG + Intronic
1174527182 20:51182273-51182295 GACCTTAATGATGATTTCACAGG - Intergenic
1175213477 20:57376331-57376353 GACTATGGTGATAGTTTCATGGG - Intronic
1175214397 20:57383815-57383837 GACTGTGGTGATGGTTTCATGGG - Intergenic
1175879995 20:62252284-62252306 GATTATGGTGATGTTTTCACGGG - Intronic
1176948556 21:15015308-15015330 AATGGTGATGATGGTTTCACAGG + Intronic
1177856089 21:26401826-26401848 GACTCTGATGATAGTTCCATTGG + Intergenic
1178095895 21:29215301-29215323 GATTGTGGTGATGGTTTCATGGG - Intronic
1178266883 21:31151642-31151664 GATTGTGACGATGGTTTCATAGG + Intronic
1178846575 21:36178881-36178903 GATTGTGGTGATGGTTTCACAGG - Intronic
1178993201 21:37372551-37372573 GCCTCTGTTCATGGTTTCATGGG - Intronic
1179161007 21:38899176-38899198 GATTGGGATGATGGTTACACAGG + Intergenic
1179435005 21:41355749-41355771 GACCATGGTGATGGTTGCACAGG + Intronic
1179911779 21:44454749-44454771 GATTGTGGTGATGGTTTCACAGG + Intergenic
1180237070 21:46468755-46468777 GTTTATGGTGATGGTTTCACAGG + Intronic
1180730786 22:17980504-17980526 GACTCTGCTGATGGTTTTCCAGG - Intronic
1180944295 22:19681266-19681288 GATTGTGGTGATGGTTTCATGGG + Intergenic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
1181995337 22:26876172-26876194 AACTGTGGTGATGATTTCACAGG - Intergenic
1182505915 22:30782221-30782243 GATTGTGGTGATGGTTTCATGGG - Intronic
1182954514 22:34409097-34409119 TACTCTGATGATAGTTTCTTTGG - Intergenic
1183049826 22:35251788-35251810 GATTTTGATGATGGTATCATGGG - Intergenic
1183974853 22:41505822-41505844 GATTGTGGTGCTGGTTTCACAGG + Intronic
1184552935 22:45214574-45214596 GATTGTGACGCTGGTTTCACAGG + Intronic
1184702160 22:46182623-46182645 GGCTATGATAGTGGTTTCACAGG + Intronic
949302835 3:2604757-2604779 GATTGTGATGATGGTTTCATGGG - Intronic
949541497 3:5035857-5035879 GATTGTGGTGATGGTTTCCCAGG - Intergenic
950101834 3:10361939-10361961 GGCACTGATGTTGGATTCACAGG + Intronic
950823308 3:15786537-15786559 GACTGTGGTGATGGTTTCATAGG + Intronic
951079070 3:18429750-18429772 GACTGTGATGACTGTTTCAAAGG - Intronic
951339661 3:21469092-21469114 GACTAAGGTGATGGTTACACTGG + Intronic
951459070 3:22929483-22929505 GATTGTGGTGATGGTTTCATGGG + Intergenic
951692732 3:25413969-25413991 GATTATGGTAATGGTTTCACAGG - Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952798491 3:37265630-37265652 GATGGTGGTGATGGTTTCACAGG - Intronic
953361913 3:42304900-42304922 GATTGTGATGATGGCTTCAAGGG - Intergenic
953435223 3:42872465-42872487 GTCTCTACTGATGGTTTCATTGG + Exonic
953604043 3:44397210-44397232 GACTGTGATAATGGCTTCATGGG - Intronic
953823657 3:46231693-46231715 GATTATGATGAGGGTTTCACAGG + Intronic
953843976 3:46412338-46412360 GACTGTGGTGATGGTTTCATTGG + Intronic
955193398 3:56783125-56783147 GCCTCTGAGCATGGTTTCAGAGG - Intronic
955284177 3:57623000-57623022 GGCTGTGATGATGGTTTTATGGG + Intergenic
955459423 3:59164401-59164423 GATTTTGGTGATGGTTTAACTGG - Intergenic
955464108 3:59218479-59218501 GATTGTGGTGATGGTTTCATGGG - Intergenic
956034516 3:65076092-65076114 CACTCTGATGATAGTTTCTTTGG + Intergenic
956218907 3:66881249-66881271 GATTGTGGTGATAGTTTCACAGG + Intergenic
956327127 3:68066116-68066138 GATTGTAGTGATGGTTTCACAGG + Intronic
957516329 3:81257405-81257427 GGCTGTAGTGATGGTTTCACAGG + Intergenic
958084407 3:88787812-88787834 GGCTGTCATGATGGTTTCATGGG + Intergenic
958093117 3:88903155-88903177 CACTCTGATGATAGTTTCTATGG + Intergenic
958466416 3:94464967-94464989 GACTCTGATGTTCTTTTCATGGG + Intergenic
958517494 3:95136865-95136887 GATTATGATGATGATTTCACAGG - Intergenic
958575593 3:95946771-95946793 GACTCTAATGATGCTTTCTCTGG + Intergenic
958985316 3:100774013-100774035 GATTGTGATGATGGTCTCATGGG + Intronic
959032544 3:101317155-101317177 AACTATAATGATGGTTTCAAGGG + Intronic
959091361 3:101906395-101906417 CACTCTGATGATAGTTTCTTTGG + Intergenic
959617536 3:108364954-108364976 CACTCTGATGATAGTTTCTATGG + Intronic
960509518 3:118531560-118531582 AATTGTGATGATAGTTTCACAGG - Intergenic
961744037 3:129052211-129052233 TCCTCTGATGCTGGTCTCACTGG + Intergenic
961968985 3:130939110-130939132 GACTATTTTGTTGGTTTCACAGG - Intronic
962432437 3:135332152-135332174 GATTATGGTGATGATTTCACAGG - Intergenic
962631997 3:137286724-137286746 CACTGTGGTGATGGTTTCATGGG - Intergenic
962758055 3:138482992-138483014 GATTGTGGTGATGATTTCACAGG + Intergenic
962914512 3:139887709-139887731 AAGTCTGATGCTGGTCTCACTGG + Intergenic
963339094 3:144012657-144012679 GCTTGTGATGATGGTTTCATAGG + Intronic
963531061 3:146473846-146473868 GACGCTCATGATGGTTTTCCAGG + Intronic
963557034 3:146805056-146805078 GAATCTCTTTATGGTTTCACAGG + Intergenic
964353177 3:155823270-155823292 GACTCTAATAGTGGTTTGACTGG + Exonic
964721367 3:159769881-159769903 GATGTTCATGATGGTTTCACAGG - Intronic
965003050 3:162982555-162982577 CACTCTGATGATAGTTTCTTTGG + Intergenic
965674207 3:171177770-171177792 GACTGTGATGATGTGTTCACAGG - Intronic
965830905 3:172788432-172788454 GATTGTGGTGATGGTTTCATGGG - Intronic
965952067 3:174321585-174321607 CACTTTGATGATTGTTTCCCTGG - Intergenic
966809935 3:183834638-183834660 GAGTGTGGTGATGGTTTCACGGG + Intronic
967764718 3:193266232-193266254 GATTGTAATGATGGTTTCATGGG + Intronic
968251304 3:197217857-197217879 GATTATAGTGATGGTTTCACAGG + Intronic
969103671 4:4788988-4789010 GACCCTGAGGCTGCTTTCACAGG - Intergenic
971214921 4:24653895-24653917 AACTCTTATGTTGGATTCACGGG + Intergenic
971289493 4:25323818-25323840 GACTGTGGTGATGATTTCACGGG - Intronic
971636150 4:29061235-29061257 GGTTGTGATGATGGTATCACTGG - Intergenic
972141120 4:35960613-35960635 GACTCTGGTGAAGGTTTTCCAGG - Intronic
972313711 4:37905573-37905595 GACTCTGGTGAAGCTTTCCCAGG + Intronic
973017421 4:45158682-45158704 GATTGTGGTAATGGTTTCACAGG - Intergenic
973062761 4:45749302-45749324 CACTCTGATGATAGTTTCTTTGG + Intergenic
973107619 4:46360149-46360171 GATTGTGGTGATGGTATCACAGG + Intronic
973308653 4:48682450-48682472 CACTCTGATGATAGTTTCTTTGG - Intronic
975421727 4:74172259-74172281 GACTATAGTGATGGTTTCTCAGG + Intronic
975515326 4:75241168-75241190 GATTATGAAGATGGTTTCATGGG - Intergenic
975590303 4:75993219-75993241 GATTGTGATGATGGTTTTATGGG - Intergenic
976013592 4:80522460-80522482 GACTCTGTTGATGGTTCCCTTGG + Intronic
976900965 4:90175440-90175462 GATTGTGGTGATGGTTTCACAGG + Intronic
977102033 4:92828972-92828994 CACTCTGATGATAGTTTCTTTGG + Intronic
977697865 4:99986941-99986963 GATTGTGGTGATGGTTTCACAGG + Intergenic
978349296 4:107804465-107804487 CTCTCTCATGATGCTTTCACAGG + Intergenic
979004892 4:115281678-115281700 GATTGTGGTGATGGTTTCATGGG + Intergenic
979686794 4:123519467-123519489 AACTCTGAAGATGGTTCCAAAGG + Intergenic
979832613 4:125319166-125319188 GACCCTGATGAAGGTGTCAATGG + Exonic
980280983 4:130719170-130719192 GTGTCTGAAGATAGTTTCACAGG - Intergenic
980483915 4:133427754-133427776 GATTGTGGTGATGGTATCACAGG + Intergenic
980838385 4:138226304-138226326 GATTGTGGTGATAGTTTCACAGG + Intronic
982098457 4:151945305-151945327 GACTGTGGTGATGATTACACAGG + Intergenic
982229389 4:153194662-153194684 CATTGTGGTGATGGTTTCACAGG + Intronic
982537108 4:156620525-156620547 GAGTCTGAAGATGCTTTCAGGGG + Intergenic
983248854 4:165321693-165321715 GATTGTGGTGATGGTTTCATGGG - Intronic
983665100 4:170172562-170172584 GATTGCGGTGATGGTTTCACAGG - Intergenic
983725580 4:170920309-170920331 GAATTTGTTGATGATTTCACAGG + Intergenic
983950154 4:173629993-173630015 GATTGTAATAATGGTTTCACAGG - Intergenic
984418692 4:179492406-179492428 GATTGTGATGATGGTTTCCTGGG - Intergenic
984957532 4:185060318-185060340 GACTGTGATGACGGTTTCATGGG - Intergenic
986013046 5:3733922-3733944 GACCCTGTTGACTGTTTCACAGG + Intergenic
986080832 5:4392253-4392275 GATTCTGGGGATGGTTTCATGGG + Intergenic
986210747 5:5669571-5669593 GATTGTGATGATGGTTGCTCAGG - Intergenic
986278763 5:6305328-6305350 GACCCAGATGATGGTTACATTGG - Intergenic
986482899 5:8206532-8206554 GATTGTGGTAATGGTTTCACAGG - Intergenic
986497515 5:8360411-8360433 GATTCTGGTGATGGTTTCATAGG + Intergenic
986548974 5:8931682-8931704 CACTCTGATGATAGTTTCTTTGG - Intergenic
986765930 5:10926456-10926478 CACTCTGATGATAGTTTCTTTGG - Intergenic
987029418 5:13962095-13962117 GATTGTGGTGATGGTTTCATGGG - Intergenic
987468565 5:18302276-18302298 TACTCTGTTGATAGTTTCACTGG + Intergenic
987765223 5:22218642-22218664 GATTATGATGGTGGCTTCACAGG + Intronic
988223392 5:28378950-28378972 CACTCTGATGATAGTTTCTTTGG + Intergenic
988378251 5:30467565-30467587 GATTATGGTGTTGGTTTCACAGG + Intergenic
988651811 5:33160736-33160758 GATTGTGATGATATTTTCACAGG - Intergenic
991007593 5:61845075-61845097 GATTCTGATGAGGGCTTCAAAGG + Intergenic
991279804 5:64899748-64899770 GATTGTGGTGATGTTTTCACAGG - Intronic
991571493 5:68059052-68059074 GATTGTGATCATGGTTTCATGGG - Intergenic
992350852 5:75927740-75927762 GGTTGTGATGATGGTTTCATGGG + Intergenic
992449922 5:76867170-76867192 GACTGTGGTGATGGTGTCACTGG - Intronic
992487108 5:77208481-77208503 AACTCTGATGTTGTTTTCCCAGG + Intergenic
992533465 5:77673913-77673935 GATTGTGGTCATGGTTTCACAGG - Intergenic
992906193 5:81348303-81348325 GATTGTGGTGATGTTTTCACAGG + Intronic
992928139 5:81612073-81612095 GGTTGTGATGATGGTTTCATGGG + Intronic
993150120 5:84151086-84151108 GAGTAAGATGATGGATTCACAGG + Intronic
993479542 5:88407343-88407365 GATTGTGATAATGGCTTCACAGG + Intergenic
993553078 5:89299682-89299704 ATTTCTGGTGATGGTTTCACAGG + Intergenic
993687699 5:90960264-90960286 CATTGTGATGATGGCTTCACAGG + Intronic
993866217 5:93199693-93199715 GATTATGTTGATGGTTTCATGGG + Intergenic
994599796 5:101888204-101888226 CACTCTGATGATAGTTTCTTTGG + Intergenic
995301354 5:110587631-110587653 TATTATGATGATGGTTTCATGGG + Intronic
995396359 5:111691232-111691254 GATTGTGGTGATGGTTTCATGGG + Intronic
995634266 5:114167754-114167776 GATTGTGGTGATGGTTTCTCAGG - Intergenic
997167390 5:131675818-131675840 GATTGTGGTGATGGTTTCAGAGG + Intronic
997458936 5:134039274-134039296 GAAACAGATGATTGTTTCACTGG + Intergenic
997876708 5:137555674-137555696 GATTGTGGTGATGGTTTCATAGG - Intronic
998072305 5:139207643-139207665 GGCTCTAATGATGGTTTGATGGG - Intronic
998645889 5:144061763-144061785 GACGGTCATGATGGTTTCATGGG - Intergenic
998928374 5:147153152-147153174 GTCTCTGATGAAGCTTTCCCAGG - Intergenic
999058038 5:148602210-148602232 GAGTGTGGTGATGGTTTCACGGG + Intronic
999436380 5:151566689-151566711 GACCCTGATGCTGGTTTTAATGG - Exonic
999454153 5:151700986-151701008 GACTCTGTGCATGGGTTCACTGG - Intergenic
999463479 5:151777740-151777762 GATTGTGGTGATGGTTTCATGGG - Intronic
999700350 5:154222041-154222063 GACTGTGATGATGGCTTCACAGG - Intronic
999717279 5:154371430-154371452 GACTCTGATGATGGTTCTACCGG - Intronic
999830760 5:155317003-155317025 GATTGTGGTGATGGTATCACTGG - Intergenic
1000436138 5:161211503-161211525 GATTGAGATGAAGGTTTCACGGG + Intergenic
1000556125 5:162728402-162728424 GATTATGGTGATGATTTCACAGG - Intergenic
1000674260 5:164101505-164101527 GAGTCTGATGAATGTCTCACAGG + Intergenic
1000732059 5:164847218-164847240 GATTGTGATGATGGTTTTACAGG - Intergenic
1001094152 5:168763124-168763146 GATTTTGATGATGCTTTGACGGG + Intronic
1001267785 5:170287665-170287687 GACACTGATGCTATTTTCACAGG + Intronic
1001369163 5:171178980-171179002 CACTCTGATGATAGTTTCTTTGG + Intronic
1001876239 5:175203859-175203881 GATTGTGGTGATGGTATCACAGG + Intergenic
1002536884 5:179880614-179880636 GACTGTGGTGATGGCTTCATGGG + Intronic
1002627925 5:180545230-180545252 GATTGTGGTGATGGTTTCACGGG - Intronic
1002794325 6:458834-458856 CACTCTGATGATAGTTTCTTTGG + Intergenic
1003055304 6:2812872-2812894 GATTGTGATGATGATTTCACAGG - Intergenic
1003111824 6:3257379-3257401 GATTGTAATGATGGTTTCACTGG - Intronic
1003111871 6:3257784-3257806 GATTGTGATGATGATTTCACTGG + Intronic
1003221845 6:4167184-4167206 GGTTGTGGTGATGGTTTCACAGG - Intergenic
1003258949 6:4498626-4498648 GCTTGTGATGATGGTTTCATGGG + Intergenic
1003362092 6:5436982-5437004 GATTGTGGTGATGGTTTCACTGG - Intronic
1003634749 6:7821976-7821998 CAGTCAGTTGATGGTTTCACTGG - Intronic
1003651289 6:7962680-7962702 GATTGTGATGATGGCTTCAATGG + Intronic
1003667416 6:8124491-8124513 GATTGTGGTGATGGTTTCATGGG - Intergenic
1005416592 6:25606338-25606360 GACTCTGCAGGTGGTTTCAGGGG + Intronic
1005769046 6:29046652-29046674 GATTGTGTTGATGGTTTCACAGG + Intergenic
1005903367 6:30238873-30238895 TGCTGTGATGATGGTTTCAGAGG - Intergenic
1006739599 6:36297890-36297912 AATTGTGGTGATGGTTTCACAGG - Intronic
1006747780 6:36356916-36356938 ACCTGTGATGATGTTTTCACGGG - Intronic
1007015406 6:38461233-38461255 GATTGTGGTGATGGTTTTACAGG - Intronic
1007921345 6:45612367-45612389 GATTGTGGTGATGGTTTCAAGGG - Intronic
1007960673 6:45956316-45956338 GACTCTGATGTTGGCTGCCCTGG + Intronic
1008257200 6:49317875-49317897 CATTCTGTTGATTGTTTCACTGG - Intergenic
1008531145 6:52460436-52460458 GATTGTAATGATGGTTTCATGGG + Intronic
1008548900 6:52608509-52608531 CACTCTGATGATAGTTTCTTTGG + Intergenic
1009281451 6:61756777-61756799 GATTGTGGTGATAGTTTCACTGG - Intronic
1009866598 6:69405941-69405963 TATTGTGGTGATGGTTTCACAGG - Intergenic
1009916287 6:70000826-70000848 CACTCTGATGATAGTTTCTCTGG + Intronic
1010276551 6:73974131-73974153 GATTGTGATGTTAGTTTCACAGG - Intergenic
1010452385 6:76017641-76017663 CATTATGGTGATGGTTTCACTGG - Intronic
1011239980 6:85261082-85261104 GATTCTCATGCTGGTTTCACAGG - Intergenic
1011638530 6:89398257-89398279 GACTGTGCTGATGGTTTCACAGG + Intronic
1011673340 6:89705803-89705825 GACTGTGATAATGGTTTCACAGG + Intronic
1012096211 6:94965505-94965527 CACTCTGATGATAGTTTCTTTGG + Intergenic
1012388877 6:98714251-98714273 GATTGTGATGATGGCTTCATAGG + Intergenic
1012572575 6:100747757-100747779 GATTGTGATGATGGTTCCATAGG + Intronic
1012819226 6:104063718-104063740 GATTGTGGTGATGGTTTCATGGG + Intergenic
1013094682 6:106933899-106933921 AACTCTGATTTTGGCTTCACTGG + Intergenic
1013794600 6:113872993-113873015 GATTTTGGCGATGGTTTCACAGG - Intergenic
1013809037 6:114023921-114023943 GATTATGGTGATGGTTTCACAGG - Intergenic
1013995409 6:116302599-116302621 CACTCTGATGATAGTTTCTTTGG + Intronic
1014418129 6:121209236-121209258 GATTGTGGTTATGGTTTCACAGG - Intronic
1014748465 6:125228286-125228308 GATTGTGATAATGGCTTCACGGG + Intronic
1014894355 6:126883720-126883742 CACTCTGATGATAGTTTCTTTGG + Intergenic
1015026711 6:128541912-128541934 GATTGTGTTGATGTTTTCACAGG - Intergenic
1015073302 6:129123963-129123985 GACGGTGGTGATGGTTTCGCTGG + Intronic
1015617344 6:135091303-135091325 AAGTCTGATGGAGGTTTCACTGG - Intronic
1015927062 6:138321186-138321208 CACTCTGGAGATGGTTTCAGTGG - Exonic
1016134253 6:140519654-140519676 GACCATGGTGATGGTTTCATGGG + Intergenic
1016265671 6:142230333-142230355 CACTCTGATGATAGTTTCTTTGG + Intergenic
1016306571 6:142690687-142690709 GATTTTAGTGATGGTTTCACAGG + Intergenic
1016755365 6:147678879-147678901 GATTGTGGTGATGGTTTCATGGG - Intronic
1016982656 6:149866962-149866984 GATTGTGGTGATGGTTTCACTGG + Intergenic
1018589379 6:165401091-165401113 GATTATGTTGATGGTTTCATGGG + Intronic
1020182795 7:5935309-5935331 GACTGAGGCGATGGTTTCACAGG - Intronic
1020300117 7:6789448-6789470 GACTGAGGCGATGGTTTCACAGG + Intronic
1020363256 7:7352706-7352728 AAGTCTGATGAAGGTCTCACTGG - Intergenic
1020609894 7:10382409-10382431 CACTCTGTTGATGGTTTCTTTGG - Intergenic
1020847451 7:13305378-13305400 CACTCTGATGATAGTTTCATTGG + Intergenic
1021088952 7:16458311-16458333 GACTCTCATCTTGGTTTCATTGG - Intergenic
1021332494 7:19356129-19356151 GATTATGGTGATGGTTTCACGGG - Intergenic
1021823927 7:24528284-24528306 GATTATGGTGATGGTTTCACAGG + Intergenic
1022155306 7:27654997-27655019 GACTGTGATGATAGCTTCACCGG + Intronic
1022637605 7:32151829-32151851 GATTATGGTGATGGGTTCACAGG + Intronic
1023029924 7:36082705-36082727 GACTTTGATGAGGGTTCAACAGG + Intronic
1023214338 7:37846243-37846265 TACTCTGATGATAGTTTCTTTGG + Intronic
1023695746 7:42844386-42844408 GACTCTGATGCAGGTTGAACTGG - Intergenic
1023898083 7:44451696-44451718 GATTGTGGTGATGGTTTCATAGG + Intronic
1026668872 7:72369220-72369242 GATTGTGGCGATGGTTTCACAGG - Intronic
1026712248 7:72752401-72752423 AACTATGGTGATAGTTTCACAGG + Intronic
1028117369 7:87014879-87014901 GATTGTTATGATGGTTTCACAGG + Intronic
1028596453 7:92551270-92551292 GATTGTGGTGATGGTTTCATAGG + Intergenic
1028897162 7:96054923-96054945 CACTCTGATGATAGTTTCTTTGG + Intronic
1029518446 7:101043546-101043568 GATTCTGATGAAGGGGTCACAGG - Exonic
1029918180 7:104233752-104233774 GATGGTGGTGATGGTTTCACAGG - Intergenic
1029968087 7:104761532-104761554 TACTCTGGTGCTGGTTTCAGAGG + Intronic
1030343521 7:108407777-108407799 GATTGTGTTGATGGTTTCACAGG + Intronic
1030707921 7:112714358-112714380 GCCTTTGGTGCTGGTTTCACAGG - Intergenic
1030760741 7:113347168-113347190 CACTCTGATGATAGTTTCTTTGG - Intergenic
1031212759 7:118851534-118851556 GATTATGGTGATGGTTTCACAGG + Intergenic
1031285543 7:119862265-119862287 GATTATGATGATGGGTTCAAAGG - Intergenic
1031297925 7:120027443-120027465 CACTCTGATGATAGTTTCTTTGG + Intergenic
1031775094 7:125898989-125899011 GACTGTGGTGATGGTTTCACAGG - Intergenic
1031812071 7:126382968-126382990 GATTGTGGTGATGGTTTCATGGG - Intergenic
1032112097 7:129084866-129084888 GACTGTGGTCATGGTTTCACGGG - Intergenic
1033301552 7:140190575-140190597 GATTGTGGTGATGGTTTCATGGG + Intergenic
1033381309 7:140822355-140822377 GAATGTGATGATGGTTGCATGGG - Intronic
1033815514 7:145068259-145068281 GATTGTGATGATTGTTTCATAGG - Intergenic
1033826385 7:145195374-145195396 GATTGTAGTGATGGTTTCACAGG - Intergenic
1033991673 7:147295322-147295344 AACTCTGATCATGGATGCACAGG + Intronic
1034481783 7:151326831-151326853 GACTCTGGTGAAGGTTTCCTGGG + Intergenic
1035403669 7:158585501-158585523 GGCTCTGATCACGGTGTCACTGG - Intronic
1035830054 8:2686138-2686160 GATTGCGTTGATGGTTTCACGGG - Intergenic
1036158742 8:6366900-6366922 GATTGTGTTGATGGTTACACAGG - Intergenic
1036398107 8:8386008-8386030 GACTGTTAGGATGGTTTCTCTGG - Intronic
1036782045 8:11656492-11656514 GATTGTGGTGATGGTTTCACGGG - Intergenic
1037021015 8:13970406-13970428 GACTTTTATCATTGTTTCACGGG - Intergenic
1037023520 8:14003785-14003807 TACTCTGATGATAGTTTCTTTGG - Intergenic
1037250216 8:16884323-16884345 TATTGTGGTGATGGTTTCACAGG + Intergenic
1037530750 8:19770432-19770454 GATTGTGGTGATGGTTTCACGGG + Intergenic
1037596167 8:20356133-20356155 GATTGTGGTGATGGTTTCACAGG - Intergenic
1038118124 8:24581012-24581034 GACTGTGGTAATGGCTTCACTGG + Intergenic
1038242711 8:25824576-25824598 GATTATGGTGATGGTTTCATGGG - Intergenic
1038281755 8:26171568-26171590 GATTGTAACGATGGTTTCACAGG + Intergenic
1038555822 8:28514460-28514482 GACTGTGGTGATGGTTTCACAGG - Intronic
1039767196 8:40641605-40641627 GATTGTGATGATGGTTTCAAAGG - Intronic
1039913273 8:41841623-41841645 GATGATAATGATGGTTTCACAGG + Intronic
1041050437 8:53929228-53929250 GATTGTGATGATGGCTTCCCAGG + Intronic
1041596238 8:59656715-59656737 GAGTCTAATAATGGGTTCACGGG - Intergenic
1042268084 8:66928797-66928819 GAATGTGGTGATGGTTTCACAGG - Intergenic
1042479963 8:69291835-69291857 GAATCTGAGAATGGTTTCAGAGG - Intergenic
1042494175 8:69437192-69437214 GATGGTGATGATGGTTTCATGGG + Intergenic
1042527357 8:69777477-69777499 GACTGTGGTGATGGCTTCACTGG + Intronic
1042769311 8:72362153-72362175 GACAGTAGTGATGGTTTCACAGG - Intergenic
1043775612 8:84264564-84264586 CACTCTGATGATAGTTTCTTTGG + Intronic
1044040194 8:87357437-87357459 GACTCTAATTATGGGTACACTGG - Intronic
1044139445 8:88631724-88631746 CATTGTGCTGATGGTTTCACAGG - Intergenic
1044381027 8:91534056-91534078 GGCTCTGATGATGGATACAGAGG - Intergenic
1044493956 8:92854204-92854226 CACTCTGATGATTGTTTCCTTGG - Intergenic
1044507070 8:93034230-93034252 GATTATGGTGATAGTTTCACAGG + Intergenic
1045538833 8:103061618-103061640 GATTGTGGTGATGGTTTCATGGG + Intronic
1045650215 8:104335249-104335271 GATTGTGATGATGTTTTCACGGG + Intronic
1045933062 8:107649162-107649184 CACTCTGATGATAGTTTCCTTGG + Intergenic
1045948483 8:107825044-107825066 CACTCTGATGATAGTTTCTTTGG + Intergenic
1046066663 8:109205365-109205387 GATTCTGCTGCTGGTTTCACAGG - Intergenic
1046077390 8:109329670-109329692 GATTGTGGTGATGATTTCACGGG + Intronic
1046556693 8:115782183-115782205 GATTGTGATAATAGTTTCACAGG - Intronic
1046798544 8:118398771-118398793 GATTGTAGTGATGGTTTCACAGG + Intronic
1046806456 8:118484502-118484524 GATTGTGGTGATGGTTTCATAGG + Intronic
1046850114 8:118962522-118962544 GATTGTGGTGATGGTATCACAGG - Intergenic
1047001203 8:120574437-120574459 GACTATGATGATGGTTTCATAGG + Intronic
1047375860 8:124295314-124295336 GAATATGGTGATGGTTTCACAGG + Intergenic
1047598562 8:126403757-126403779 AATTGTGATGATGGTTTCATGGG + Intergenic
1047881061 8:129193992-129194014 GAATCTGCTGACGGTTTCATAGG + Intergenic
1047949225 8:129915623-129915645 GATTGTGGTGATGGTTTCATAGG + Intronic
1048768133 8:137866710-137866732 GACTGTGATGATAGTCTCATGGG - Intergenic
1050116160 9:2265589-2265611 GACACTGATTTTGGTTTCCCTGG + Intergenic
1050639453 9:7651698-7651720 AACTGTGCTGATGCTTTCACAGG + Intergenic
1051541041 9:18217744-18217766 GAGACTGATGCTGGCTTCACTGG + Intergenic
1051597023 9:18834537-18834559 GATTGTGGTGATGATTTCACAGG - Intronic
1051763563 9:20497357-20497379 GACTATGGTGATGGTTTCCTGGG - Intronic
1051813009 9:21072128-21072150 GACTGTGTTGATGGTTTCAGGGG - Intergenic
1052127538 9:24796223-24796245 GATTGTGGTGATGATTTCACAGG + Intergenic
1052510910 9:29418862-29418884 AATTGTGATGATGGTTTCACAGG - Intergenic
1052799924 9:32957534-32957556 GCCTCTGCTGATGGTTTCCTTGG + Intergenic
1053209526 9:36216151-36216173 GATTGTGGTGATGCTTTCACAGG + Exonic
1053244272 9:36521748-36521770 GATTGTGTTGATGGTTTCACAGG + Intergenic
1054747309 9:68867625-68867647 GATTGTGGTGATGGTTTCACAGG + Intronic
1055221479 9:73937966-73937988 GATTATGGTGATGGTTTCATAGG + Intergenic
1055542268 9:77323640-77323662 GACTGTGATGACAGTTTCAAAGG - Intronic
1056417892 9:86395153-86395175 CACTCTGATGGTGGTTTCTTTGG - Intergenic
1056695197 9:88843323-88843345 AACTATGGTGATGGTTTCATGGG - Intergenic
1056849318 9:90068887-90068909 GATTGTGGTGATGGTTTCACAGG - Intergenic
1056995684 9:91455732-91455754 GAATGTGGTGATGGTGTCACAGG - Intergenic
1057361886 9:94380899-94380921 GATTATGATAATGGTTTCACAGG - Intronic
1057661471 9:97007265-97007287 GATTATGATAATGGTTTCACAGG + Intronic
1058364560 9:104193316-104193338 GACTGTAATTATGGTTTCATAGG - Intergenic
1058547337 9:106074590-106074612 GATTGTGGTGATGGTTTCATGGG - Intergenic
1058725264 9:107797269-107797291 GACTGTGGTGATGGTTTCATGGG - Intergenic
1059257530 9:112945038-112945060 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1059536586 9:115086532-115086554 GAGTGTGATGATGGTTTCACTGG - Exonic
1059536631 9:115086811-115086833 GTGTGTGATGAGGGTTTCACGGG - Exonic
1059797701 9:117716785-117716807 GATTGTGGTGATGGTTTGACAGG + Exonic
1059979124 9:119750173-119750195 CACTCTGTTGATTGTTTCCCTGG + Intergenic
1060081022 9:120645405-120645427 AACTGTGATGATGCTTTAACTGG - Intronic
1060273248 9:122162894-122162916 GATTGTGATGATGTTTTCCCAGG + Intronic
1060439286 9:123623838-123623860 GACCCTGCTGTTGGTATCACAGG - Intronic
1061529550 9:131199422-131199444 GACTCTCCTGCTGGTTCCACTGG - Intronic
1061614206 9:131768789-131768811 GACCCTAGTGATGGTTTGACGGG + Intergenic
1062144552 9:134981789-134981811 GAGGATGATGATGGTTACACAGG + Intergenic
1062144560 9:134981827-134981849 GAGGATGATGATGGTTACACAGG + Intergenic
1062144584 9:134981941-134981963 GAGGATGATGATGGTTACACAGG + Intergenic
1062409013 9:136412351-136412373 GATTGTGCTGATGGTTTCACAGG - Intronic
1062728392 9:138092894-138092916 CACTCTGTTGATTATTTCACTGG - Intronic
1186347420 X:8708296-8708318 CACTCTGATGATAGTTTCTTAGG - Intronic
1186385771 X:9109035-9109057 GATTGTGGTGATGGTTTCACAGG - Intronic
1186484221 X:9921381-9921403 GATTGTGGTGATGATTTCACAGG - Intronic
1186547634 X:10467433-10467455 GACACTGATGATTTTTTCCCAGG + Intronic
1187806176 X:23123377-23123399 GACTATAATAATGGTTGCACTGG - Intergenic
1188022618 X:25175333-25175355 GACACTGATCATGGTATCTCAGG + Intergenic
1188624042 X:32262418-32262440 GACTGTGCTAATAGTTTCACTGG + Intronic
1188702357 X:33280620-33280642 GATTGTGGTGATGGTTTCACAGG + Intronic
1188772266 X:34166927-34166949 CACTCTGATGATAGTTTCTTCGG + Intergenic
1188892012 X:35623213-35623235 GATTGTGATGATGGTTTCACAGG + Intergenic
1188970080 X:36604718-36604740 CCCTGTGAGGATGGTTTCACTGG - Intergenic
1189673208 X:43434316-43434338 GATGATGATGATAGTTTCACAGG + Intergenic
1189679122 X:43496581-43496603 GATTGTGGTGATGGTTTCATGGG + Intergenic
1189860826 X:45270116-45270138 TACTCTGTTAATGGTTTCATTGG + Intergenic
1189902141 X:45717448-45717470 GATTGTGAAGATGGCTTCACAGG + Intergenic
1189905075 X:45750393-45750415 GATTATGGTGATGGTATCACAGG + Intergenic
1189932529 X:46029405-46029427 GACCATGGTGATGGTATCACAGG - Intergenic
1189950722 X:46227845-46227867 GAATGTGGTGATGGTTTCACAGG + Intergenic
1190599578 X:52076598-52076620 TACTATAATGATTGTTTCACAGG + Intergenic
1190609246 X:52177475-52177497 TACTATAATGATTGTTTCACAGG - Intergenic
1190856805 X:54304062-54304084 GAAACTGGTGATGGTTACACGGG - Intronic
1191011300 X:55762180-55762202 AAGTCTGATGTGGGTTTCACTGG - Intergenic
1191115896 X:56852323-56852345 CACTCTGATGATAGTTTCTTTGG - Intergenic
1191927120 X:66325488-66325510 GATTGTGTTGATGGTTTCATGGG + Intergenic
1192303496 X:69932269-69932291 GATTGTGATGATGGTTTCACAGG + Intronic
1192440009 X:71167352-71167374 GACCCTGAGGATGGTGTCTCTGG + Exonic
1192605166 X:72508979-72509001 GATTGTGGTGATGGTTTCATGGG - Intronic
1193646666 X:84078870-84078892 GATTTTCATGATGGTTTCATGGG + Intronic
1193850121 X:86527278-86527300 GACTGTGGTGATGGTTTCATAGG - Intronic
1194824743 X:98547945-98547967 GATTGTGATGATGGTTTCATGGG - Intergenic
1195030821 X:100926258-100926280 ATCTCTGAAGATGGCTTCACAGG - Intronic
1195293425 X:103451302-103451324 GACTATGGTGTTGGTTTCATTGG - Intergenic
1195682272 X:107556544-107556566 GATTGTGGTGATGGTTTCATGGG - Intronic
1195919394 X:109967552-109967574 GATTATGTTGATGCTTTCACAGG - Intergenic
1196115246 X:111992268-111992290 GATTGTGGTGATGGTTTCACAGG + Intronic
1196280238 X:113815665-113815687 GATTGTGGTGATGATTTCACAGG + Intergenic
1196339118 X:114575663-114575685 GATTGTGGTGATGATTTCACAGG + Intergenic
1196567294 X:117223849-117223871 GATGGTGGTGATGGTTTCACTGG - Intergenic
1197310589 X:124900456-124900478 GATTGTGGTGATAGTTTCACAGG + Intronic
1197367838 X:125587599-125587621 GATTGTGATGATGGTATCATAGG - Intergenic
1197726259 X:129778696-129778718 GACTGTGGTGATGATTTCATGGG - Intergenic
1198594129 X:138217624-138217646 GATTGTGATGATGATTTTACAGG + Intergenic
1199104383 X:143845617-143845639 GACTCAGGTAATGGTTTCTCTGG + Intergenic
1199419052 X:147621827-147621849 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1199428661 X:147733537-147733559 GATTGTGGTGATGGTATCACTGG + Intergenic
1199784596 X:151093120-151093142 GATAATGGTGATGGTTTCACAGG - Intergenic
1199998307 X:153041203-153041225 GACTGTGGTGATGGGTTCACAGG - Intergenic
1200306908 X:155035467-155035489 GACTGTGGTGATGGTTTTATGGG - Intronic
1201920142 Y:19225300-19225322 CACTCTGATGATAGTTTCTTTGG + Intergenic
1201959416 Y:19662251-19662273 CACTCTGATGATAGTTTCTTTGG - Intergenic
1202162123 Y:21945628-21945650 GGTTCTGATGATGACTTCACAGG - Intergenic
1202229233 Y:22640745-22640767 GGTTCTGATGATGACTTCACAGG + Intergenic
1202313921 Y:23555421-23555443 GGTTCTGATGATGACTTCACAGG - Intergenic
1202556881 Y:26115174-26115196 GGTTCTGATGATGACTTCACAGG + Intergenic