ID: 1168616972

View in Genome Browser
Species Human (GRCh38)
Location 19:57846050-57846072
Sequence GACTCTGATGATGGTTTCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 2, 2: 19, 3: 128, 4: 595}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168616972_1168616976 21 Left 1168616972 19:57846050-57846072 CCCGTGAAACCATCATCAGAGTC 0: 1
1: 2
2: 19
3: 128
4: 595
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168616972 Original CRISPR GACTCTGATGATGGTTTCAC GGG (reversed) Exonic