ID: 1168616976

View in Genome Browser
Species Human (GRCh38)
Location 19:57846094-57846116
Sequence CTATCACCTTTGTATTTACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168616974_1168616976 12 Left 1168616974 19:57846059-57846081 CCATCATCAGAGTCACCATAATG 0: 1
1: 2
2: 0
3: 26
4: 257
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194
1168616972_1168616976 21 Left 1168616972 19:57846050-57846072 CCCGTGAAACCATCATCAGAGTC 0: 1
1: 2
2: 19
3: 128
4: 595
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194
1168616975_1168616976 -3 Left 1168616975 19:57846074-57846096 CCATAATGAATTTATCTAATCTA 0: 1
1: 0
2: 5
3: 57
4: 611
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194
1168616973_1168616976 20 Left 1168616973 19:57846051-57846073 CCGTGAAACCATCATCAGAGTCA 0: 3
1: 0
2: 18
3: 178
4: 502
Right 1168616976 19:57846094-57846116 CTATCACCTTTGTATTTACTTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168616976 Original CRISPR CTATCACCTTTGTATTTACT TGG Exonic