ID: 1168620803

View in Genome Browser
Species Human (GRCh38)
Location 19:57877973-57877995
Sequence TGGTTAACAATGTGCAACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168620798_1168620803 4 Left 1168620798 19:57877946-57877968 CCTGAGGTCCGGAGTTTCAGACC 0: 4
1: 521
2: 31042
3: 98533
4: 76183
Right 1168620803 19:57877973-57877995 TGGTTAACAATGTGCAACTTCGG No data
1168620794_1168620803 21 Left 1168620794 19:57877929-57877951 CCGAGCCAGGTGGATTGCCTGAG 0: 2
1: 588
2: 3318
3: 23048
4: 52806
Right 1168620803 19:57877973-57877995 TGGTTAACAATGTGCAACTTCGG No data
1168620800_1168620803 -4 Left 1168620800 19:57877954-57877976 CCGGAGTTTCAGACCAGCCTGGT 0: 1
1: 26
2: 656
3: 2094
4: 2757
Right 1168620803 19:57877973-57877995 TGGTTAACAATGTGCAACTTCGG No data
1168620796_1168620803 16 Left 1168620796 19:57877934-57877956 CCAGGTGGATTGCCTGAGGTCCG 0: 1
1: 5
2: 37
3: 264
4: 545
Right 1168620803 19:57877973-57877995 TGGTTAACAATGTGCAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168620803 Original CRISPR TGGTTAACAATGTGCAACTT CGG Intronic
No off target data available for this crispr