ID: 1168624230

View in Genome Browser
Species Human (GRCh38)
Location 19:57904252-57904274
Sequence GTGCGGATGTGGGGGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624230_1168624240 24 Left 1168624230 19:57904252-57904274 CCTGTCTGCCCCCACATCCGCAC No data
Right 1168624240 19:57904299-57904321 TGATTACCAATAAATAGTGTGGG No data
1168624230_1168624239 23 Left 1168624230 19:57904252-57904274 CCTGTCTGCCCCCACATCCGCAC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624230 Original CRISPR GTGCGGATGTGGGGGCAGAC AGG (reversed) Intronic