ID: 1168624231 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:57904260-57904282 |
| Sequence | GAGAGGACGTGCGGATGTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1168624231_1168624240 | 16 | Left | 1168624231 | 19:57904260-57904282 | CCCCCACATCCGCACGTCCTCTC | No data | ||
| Right | 1168624240 | 19:57904299-57904321 | TGATTACCAATAAATAGTGTGGG | No data | ||||
| 1168624231_1168624239 | 15 | Left | 1168624231 | 19:57904260-57904282 | CCCCCACATCCGCACGTCCTCTC | No data | ||
| Right | 1168624239 | 19:57904298-57904320 | TTGATTACCAATAAATAGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1168624231 | Original CRISPR | GAGAGGACGTGCGGATGTGG GGG (reversed) | Intronic | ||