ID: 1168624232

View in Genome Browser
Species Human (GRCh38)
Location 19:57904261-57904283
Sequence GGAGAGGACGTGCGGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624232_1168624239 14 Left 1168624232 19:57904261-57904283 CCCCACATCCGCACGTCCTCTCC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624232_1168624242 30 Left 1168624232 19:57904261-57904283 CCCCACATCCGCACGTCCTCTCC No data
Right 1168624242 19:57904314-57904336 AGTGTGGGCTCCTAGAGCTCAGG No data
1168624232_1168624240 15 Left 1168624232 19:57904261-57904283 CCCCACATCCGCACGTCCTCTCC No data
Right 1168624240 19:57904299-57904321 TGATTACCAATAAATAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624232 Original CRISPR GGAGAGGACGTGCGGATGTG GGG (reversed) Intronic