ID: 1168624234

View in Genome Browser
Species Human (GRCh38)
Location 19:57904263-57904285
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624234_1168624243 29 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624234_1168624242 28 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624242 19:57904314-57904336 AGTGTGGGCTCCTAGAGCTCAGG No data
1168624234_1168624239 12 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624234_1168624240 13 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624240 19:57904299-57904321 TGATTACCAATAAATAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624234 Original CRISPR GTGGAGAGGACGTGCGGATG TGG (reversed) Intronic