ID: 1168624237

View in Genome Browser
Species Human (GRCh38)
Location 19:57904282-57904304
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624237_1168624240 -6 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624240 19:57904299-57904321 TGATTACCAATAAATAGTGTGGG No data
1168624237_1168624242 9 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624242 19:57904314-57904336 AGTGTGGGCTCCTAGAGCTCAGG No data
1168624237_1168624243 10 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624237_1168624239 -7 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624237 Original CRISPR TAATCAAACAAAGAAGCAGG TGG (reversed) Intronic