ID: 1168624238

View in Genome Browser
Species Human (GRCh38)
Location 19:57904285-57904307
Sequence TGGTAATCAAACAAAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624238_1168624240 -9 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624240 19:57904299-57904321 TGATTACCAATAAATAGTGTGGG No data
1168624238_1168624245 28 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624245 19:57904336-57904358 GGCCTTTGCAGCCTCCATACTGG No data
1168624238_1168624243 7 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624238_1168624239 -10 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624238_1168624242 6 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624242 19:57904314-57904336 AGTGTGGGCTCCTAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624238 Original CRISPR TGGTAATCAAACAAAGAAGC AGG (reversed) Intronic