ID: 1168624239

View in Genome Browser
Species Human (GRCh38)
Location 19:57904298-57904320
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624233_1168624239 13 Left 1168624233 19:57904262-57904284 CCCACATCCGCACGTCCTCTCCA No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624230_1168624239 23 Left 1168624230 19:57904252-57904274 CCTGTCTGCCCCCACATCCGCAC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624232_1168624239 14 Left 1168624232 19:57904261-57904283 CCCCACATCCGCACGTCCTCTCC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624234_1168624239 12 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624235_1168624239 6 Left 1168624235 19:57904269-57904291 CCGCACGTCCTCTCCACCTGCTT No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624237_1168624239 -7 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624238_1168624239 -10 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624231_1168624239 15 Left 1168624231 19:57904260-57904282 CCCCCACATCCGCACGTCCTCTC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624236_1168624239 -2 Left 1168624236 19:57904277-57904299 CCTCTCCACCTGCTTCTTTGTTT No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data
1168624229_1168624239 28 Left 1168624229 19:57904247-57904269 CCTCACCTGTCTGCCCCCACATC No data
Right 1168624239 19:57904298-57904320 TTGATTACCAATAAATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type