ID: 1168624243

View in Genome Browser
Species Human (GRCh38)
Location 19:57904315-57904337
Sequence GTGTGGGCTCCTAGAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624238_1168624243 7 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624233_1168624243 30 Left 1168624233 19:57904262-57904284 CCCACATCCGCACGTCCTCTCCA No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624237_1168624243 10 Left 1168624237 19:57904282-57904304 CCACCTGCTTCTTTGTTTGATTA No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624234_1168624243 29 Left 1168624234 19:57904263-57904285 CCACATCCGCACGTCCTCTCCAC No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624235_1168624243 23 Left 1168624235 19:57904269-57904291 CCGCACGTCCTCTCCACCTGCTT No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data
1168624236_1168624243 15 Left 1168624236 19:57904277-57904299 CCTCTCCACCTGCTTCTTTGTTT No data
Right 1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624243 Original CRISPR GTGTGGGCTCCTAGAGCTCA GGG Intronic