ID: 1168624245

View in Genome Browser
Species Human (GRCh38)
Location 19:57904336-57904358
Sequence GGCCTTTGCAGCCTCCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168624241_1168624245 8 Left 1168624241 19:57904305-57904327 CCAATAAATAGTGTGGGCTCCTA No data
Right 1168624245 19:57904336-57904358 GGCCTTTGCAGCCTCCATACTGG No data
1168624238_1168624245 28 Left 1168624238 19:57904285-57904307 CCTGCTTCTTTGTTTGATTACCA No data
Right 1168624245 19:57904336-57904358 GGCCTTTGCAGCCTCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168624245 Original CRISPR GGCCTTTGCAGCCTCCATAC TGG Intronic